Incidental Mutation 'R5375:Dtx3l'
ID429041
Institutional Source Beutler Lab
Gene Symbol Dtx3l
Ensembl Gene ENSMUSG00000049502
Gene Namedeltex 3-like, E3 ubiquitin ligase
Synonyms
MMRRC Submission 042951-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35926511-35939151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35933027 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 403 (I403N)
Ref Sequence ENSEMBL: ENSMUSP00000110535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081933] [ENSMUST00000114885]
Predicted Effect probably damaging
Transcript: ENSMUST00000081933
AA Change: I403N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080601
Gene: ENSMUSG00000049502
AA Change: I403N

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114885
AA Change: I403N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110535
Gene: ENSMUSG00000049502
AA Change: I403N

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3L functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,210,870 N995K probably damaging Het
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Babam2 T A 5: 31,701,863 I5N possibly damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Bloc1s1 T C 10: 128,923,957 probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyld A G 8: 88,733,036 E440G possibly damaging Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dclre1b C T 3: 103,803,974 R207H probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Fgfr2 T C 7: 130,241,215 N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Lgr5 C T 10: 115,478,564 S156N probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Polq A T 16: 37,082,784 D1980V probably damaging Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Dtx3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Dtx3l APN 16 35931502 missense probably benign 0.10
IGL02255:Dtx3l APN 16 35933336 missense probably benign 0.10
R0560:Dtx3l UTSW 16 35932935 missense probably damaging 1.00
R1123:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1127:Dtx3l UTSW 16 35938757 missense possibly damaging 0.74
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1584:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1690:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1929:Dtx3l UTSW 16 35933689 missense possibly damaging 0.95
R2014:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2015:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2255:Dtx3l UTSW 16 35936579 missense probably benign 0.01
R3023:Dtx3l UTSW 16 35932436 missense probably benign 0.01
R3176:Dtx3l UTSW 16 35932173 missense probably benign 0.29
R5224:Dtx3l UTSW 16 35938793 missense possibly damaging 0.93
R5233:Dtx3l UTSW 16 35933238 missense possibly damaging 0.49
R5884:Dtx3l UTSW 16 35932233 missense probably benign
R6821:Dtx3l UTSW 16 35933060 missense probably damaging 1.00
R6994:Dtx3l UTSW 16 35931372 critical splice donor site probably null
R7242:Dtx3l UTSW 16 35933401 missense possibly damaging 0.76
R7270:Dtx3l UTSW 16 35933657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCGAGCTCTCTCCTTGC -3'
(R):5'- CCAAAGCTCTTGATAAAGGGACAG -3'

Sequencing Primer
(F):5'- GCCCAACCCTTTCAGCG -3'
(R):5'- GGAAGAACGCTGACTCTCCTC -3'
Posted On2016-09-06