Incidental Mutation 'R5447:Neu4'
ID429103
Institutional Source Beutler Lab
Gene Symbol Neu4
Ensembl Gene ENSMUSG00000034000
Gene Namesialidase 4
Synonyms
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location94020451-94028334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94022418 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 33 (T33M)
Ref Sequence ENSEMBL: ENSMUSP00000140127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050890] [ENSMUST00000190212]
Predicted Effect probably damaging
Transcript: ENSMUST00000050890
AA Change: T10M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051151
Gene: ENSMUSG00000034000
AA Change: T10M

DomainStartEndE-ValueType
Pfam:BNR_3 24 256 5.8e-10 PFAM
Pfam:BNR_2 34 270 2e-29 PFAM
SCOP:d3sil__ 371 448 4e-12 SMART
PDB:2F13|A 371 455 8e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000190212
AA Change: T33M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140127
Gene: ENSMUSG00000034000
AA Change: T33M

DomainStartEndE-ValueType
Pfam:BNR_3 47 279 1.6e-6 PFAM
Pfam:BNR_2 58 304 4.6e-25 PFAM
SCOP:d3sil__ 394 471 4e-12 SMART
PDB:2F29|B 394 478 1e-11 PDB
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of glycohydrolytic enzymes, which remove terminal sialic acid residues from various sialo derivatives, such as glycoproteins, glycolipids, oligosaccharides, and gangliosides. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele are largely normal except increased lipid content in the lung and liver and vacuolization indicative of lysosomal storage disorder. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nfxl1 C T 5: 72,529,169 R563Q probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Neu4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Neu4 APN 1 94024491 missense probably damaging 1.00
IGL03348:Neu4 APN 1 94024974 missense possibly damaging 0.77
R0018:Neu4 UTSW 1 94025338 missense probably benign 0.00
R0018:Neu4 UTSW 1 94025338 missense probably benign 0.00
R0645:Neu4 UTSW 1 94022469 missense probably damaging 1.00
R0813:Neu4 UTSW 1 94022876 frame shift probably null
R0814:Neu4 UTSW 1 94022876 frame shift probably null
R2056:Neu4 UTSW 1 94022450 missense possibly damaging 0.77
R4354:Neu4 UTSW 1 94024557 missense probably damaging 1.00
R4922:Neu4 UTSW 1 94022478 missense probably damaging 0.98
R5156:Neu4 UTSW 1 94024455 missense probably damaging 1.00
R5268:Neu4 UTSW 1 94024947 missense probably benign 0.18
R5862:Neu4 UTSW 1 94022930 missense probably benign 0.20
R6280:Neu4 UTSW 1 94025151 missense probably damaging 1.00
R6697:Neu4 UTSW 1 94025030 missense probably benign 0.00
R7192:Neu4 UTSW 1 94025141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTGGGCTGAGGCAGATAG -3'
(R):5'- TCCAGGGAGATCTATAGAGCTGG -3'

Sequencing Primer
(F):5'- CTGTGATCCATCCAATAGCTGAGG -3'
(R):5'- AGCTGGGCTCAGTTTCCTCTG -3'
Posted On2016-09-06