Incidental Mutation 'R5448:C1galt1'
ID429172
Institutional Source Beutler Lab
Gene Symbol C1galt1
Ensembl Gene ENSMUSG00000042460
Gene Namecore 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
SynonymsT-synthase, core 1 beta3-Gal-T, 2210410E06Rik
MMRRC Submission 043013-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5448 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location7844842-7875687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7866658 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 168 (A168V)
Ref Sequence ENSEMBL: ENSMUSP00000047931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040159
AA Change: A168V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047931
Gene: ENSMUSG00000042460
AA Change: A168V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 83 283 3e-18 PFAM
Pfam:Galactosyl_T 108 258 6.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203898
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene generates the common core 1 O-glycan structure, Gal-beta-1-3GalNAc-R, by the transfer of Gal from UDP-Gal to GalNAc-alpha-1-R. Core 1 is a precursor for many extended mucin-type O-glycans on cell surface and secreted glycoproteins. Studies in mice suggest that this gene plays a key role in thrombopoiesis and kidney homeostasis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Embryos homozygous for a null allele show impaired angiogenesis, chaotic microvascular networks in brain, and fatal hemorrhage by E14. Eggs homozygous for another null allele show a slightly thinner zona pellucida. Mice homozygous for an ENU-induced allele develop thrombocytopenia and renal disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Actn3 T C 19: 4,863,211 D699G possibly damaging Het
Ccdc180 A T 4: 45,920,913 E953V probably damaging Het
Ccdc88b T A 19: 6,854,580 D411V probably damaging Het
Cdadc1 T A 14: 59,573,826 I412L possibly damaging Het
Clip2 T C 5: 134,514,048 N424D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fam35a G A 14: 34,268,370 T193I probably benign Het
Fbxo38 A T 18: 62,522,457 I386N possibly damaging Het
Gm9887 C A 12: 69,372,091 probably benign Het
Itgae T C 11: 73,133,908 probably null Het
Klhl2 C A 8: 64,822,990 probably null Het
Krt1 T A 15: 101,849,029 K249* probably null Het
L3mbtl2 T C 15: 81,684,333 Y513H possibly damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Olfr1217 T G 2: 89,023,501 L167F probably benign Het
Olfr395 T C 11: 73,906,611 N294D probably damaging Het
Pcnx2 T C 8: 125,888,149 T188A probably benign Het
Pde6c A G 19: 38,133,175 E77G probably damaging Het
Pgr A G 9: 8,922,637 I603V probably benign Het
Plce1 T C 19: 38,779,917 V2212A probably damaging Het
Ppl C T 16: 5,107,566 A70T probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Prrx1 T C 1: 163,248,298 E233G probably damaging Het
Rdh16f2 C T 10: 127,877,063 T310I probably benign Het
Rfx6 T C 10: 51,683,637 S187P probably damaging Het
Scn10a A T 9: 119,687,947 F135I probably benign Het
Slc24a1 A G 9: 64,948,327 F433L probably benign Het
Slfn3 T A 11: 83,214,605 L476Q probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Trappc1 T C 11: 69,325,535 S136P probably benign Het
Tshz3 A G 7: 36,771,229 E881G possibly damaging Het
Ubash3b A G 9: 41,037,435 probably null Het
Wdtc1 G A 4: 133,294,297 A642V probably benign Het
Zdhhc22 T C 12: 86,988,567 D37G possibly damaging Het
Other mutations in C1galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:C1galt1 APN 6 7866475 missense probably damaging 0.98
PIT4378001:C1galt1 UTSW 6 7863944 missense probably benign 0.01
R0086:C1galt1 UTSW 6 7867051 splice site probably benign
R0540:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R0567:C1galt1 UTSW 6 7866874 missense probably damaging 1.00
R0607:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R1519:C1galt1 UTSW 6 7866402 missense probably damaging 0.99
R1712:C1galt1 UTSW 6 7871217 missense probably benign
R2989:C1galt1 UTSW 6 7866622 missense possibly damaging 0.50
R3035:C1galt1 UTSW 6 7866762 missense probably benign 0.06
R4271:C1galt1 UTSW 6 7866607 missense probably damaging 1.00
R4749:C1galt1 UTSW 6 7866379 missense probably benign 0.42
R5029:C1galt1 UTSW 6 7863931 missense possibly damaging 0.95
R5393:C1galt1 UTSW 6 7864143 critical splice donor site probably null
R7055:C1galt1 UTSW 6 7866585 missense probably damaging 1.00
R7319:C1galt1 UTSW 6 7871150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCCAGCGTTGTAATAAAG -3'
(R):5'- CCCAGAGCTAAGTCTTCGATG -3'

Sequencing Primer
(F):5'- CTTCCCTACTGTGGGATT -3'
(R):5'- CTTCGATGGAGGAACTATGTGTACAC -3'
Posted On2016-09-06