Incidental Mutation 'R5448:Tshz3'
ID429173
Institutional Source Beutler Lab
Gene Symbol Tshz3
Ensembl Gene ENSMUSG00000021217
Gene Nameteashirt zinc finger family member 3
SynonymsTsh3, teashirt3, A630038G13Rik, Zfp537
MMRRC Submission 043013-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5448 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location36698118-36773553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36771229 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 881 (E881G)
Ref Sequence ENSEMBL: ENSMUSP00000021641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021641
AA Change: E881G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021641
Gene: ENSMUSG00000021217
AA Change: E881G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
low complexity region 142 164 N/A INTRINSIC
ZnF_C2H2 214 238 1.86e0 SMART
ZnF_C2H2 275 299 3.83e-2 SMART
low complexity region 313 334 N/A INTRINSIC
ZnF_C2H2 386 410 5.62e0 SMART
low complexity region 483 497 N/A INTRINSIC
coiled coil region 609 630 N/A INTRINSIC
low complexity region 796 832 N/A INTRINSIC
low complexity region 855 872 N/A INTRINSIC
HOX 890 964 2.55e-4 SMART
ZnF_C2H2 976 998 8.09e0 SMART
ZnF_C2H2 1041 1064 2.4e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcription factor that regulates smooth muscle cell differentiation in the developing urinary tract. Consistent with this role, mice in which this gene has been inactivated exhibit abnormal gene expression in urinary tract smooth muscle cell precursors and kidney defects including hydronephrosis. The encoded transcription factor comprises a gene silencing complex that inhibits caspase expression. Reduced expression of this gene and consequent caspase upregulation may be correlated with progression of Alzheimer's disease in human patients. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit neoatal lethality likely due to respiratory distress and hydroureter and hydronephrosis associated with impaired development of ureteric smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Actn3 T C 19: 4,863,211 D699G possibly damaging Het
C1galt1 C T 6: 7,866,658 A168V possibly damaging Het
Ccdc180 A T 4: 45,920,913 E953V probably damaging Het
Ccdc88b T A 19: 6,854,580 D411V probably damaging Het
Cdadc1 T A 14: 59,573,826 I412L possibly damaging Het
Clip2 T C 5: 134,514,048 N424D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fam35a G A 14: 34,268,370 T193I probably benign Het
Fbxo38 A T 18: 62,522,457 I386N possibly damaging Het
Gm9887 C A 12: 69,372,091 probably benign Het
Itgae T C 11: 73,133,908 probably null Het
Klhl2 C A 8: 64,822,990 probably null Het
Krt1 T A 15: 101,849,029 K249* probably null Het
L3mbtl2 T C 15: 81,684,333 Y513H possibly damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Olfr1217 T G 2: 89,023,501 L167F probably benign Het
Olfr395 T C 11: 73,906,611 N294D probably damaging Het
Pcnx2 T C 8: 125,888,149 T188A probably benign Het
Pde6c A G 19: 38,133,175 E77G probably damaging Het
Pgr A G 9: 8,922,637 I603V probably benign Het
Plce1 T C 19: 38,779,917 V2212A probably damaging Het
Ppl C T 16: 5,107,566 A70T probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Prrx1 T C 1: 163,248,298 E233G probably damaging Het
Rdh16f2 C T 10: 127,877,063 T310I probably benign Het
Rfx6 T C 10: 51,683,637 S187P probably damaging Het
Scn10a A T 9: 119,687,947 F135I probably benign Het
Slc24a1 A G 9: 64,948,327 F433L probably benign Het
Slfn3 T A 11: 83,214,605 L476Q probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Trappc1 T C 11: 69,325,535 S136P probably benign Het
Ubash3b A G 9: 41,037,435 probably null Het
Wdtc1 G A 4: 133,294,297 A642V probably benign Het
Zdhhc22 T C 12: 86,988,567 D37G possibly damaging Het
Other mutations in Tshz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Tshz3 APN 7 36769960 missense probably damaging 0.97
IGL01922:Tshz3 APN 7 36769605 missense probably damaging 1.00
IGL02047:Tshz3 APN 7 36770468 missense probably damaging 1.00
IGL02166:Tshz3 APN 7 36768921 missense probably benign 0.00
IGL02405:Tshz3 APN 7 36769650 missense possibly damaging 0.93
IGL02658:Tshz3 APN 7 36769158 missense probably damaging 0.99
IGL02968:Tshz3 APN 7 36769824 missense probably damaging 1.00
IGL03073:Tshz3 APN 7 36770745 missense probably damaging 1.00
IGL03233:Tshz3 APN 7 36770079 missense probably damaging 0.97
IGL03296:Tshz3 APN 7 36771336 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0090:Tshz3 UTSW 7 36768892 missense probably benign
R0329:Tshz3 UTSW 7 36770033 missense probably benign
R0330:Tshz3 UTSW 7 36770033 missense probably benign
R0360:Tshz3 UTSW 7 36770533 missense probably benign
R0364:Tshz3 UTSW 7 36770533 missense probably benign
R0380:Tshz3 UTSW 7 36771300 missense probably damaging 1.00
R0547:Tshz3 UTSW 7 36771417 missense probably damaging 1.00
R1061:Tshz3 UTSW 7 36768706 missense probably damaging 1.00
R1618:Tshz3 UTSW 7 36771796 missense probably damaging 1.00
R1704:Tshz3 UTSW 7 36771360 missense possibly damaging 0.92
R1881:Tshz3 UTSW 7 36771654 missense possibly damaging 0.87
R1926:Tshz3 UTSW 7 36769375 missense probably damaging 1.00
R1994:Tshz3 UTSW 7 36769822 missense probably damaging 0.99
R2404:Tshz3 UTSW 7 36770380 missense probably damaging 0.99
R2447:Tshz3 UTSW 7 36768753 missense probably benign 0.00
R2930:Tshz3 UTSW 7 36771592 missense possibly damaging 0.74
R3879:Tshz3 UTSW 7 36771537 nonsense probably null
R4033:Tshz3 UTSW 7 36770584 missense possibly damaging 0.71
R4212:Tshz3 UTSW 7 36770119 missense probably damaging 1.00
R4394:Tshz3 UTSW 7 36769605 missense probably damaging 1.00
R4779:Tshz3 UTSW 7 36768972 missense probably damaging 1.00
R4977:Tshz3 UTSW 7 36771190 missense probably benign 0.31
R5139:Tshz3 UTSW 7 36771025 missense probably benign 0.23
R5516:Tshz3 UTSW 7 36770350 missense probably benign 0.03
R5760:Tshz3 UTSW 7 36771569 missense probably damaging 1.00
R6360:Tshz3 UTSW 7 36769441 missense probably damaging 1.00
R6481:Tshz3 UTSW 7 36752339 intron probably null
R6535:Tshz3 UTSW 7 36768789 missense probably damaging 1.00
R7105:Tshz3 UTSW 7 36769756 missense probably damaging 1.00
R7133:Tshz3 UTSW 7 36770569 missense probably benign 0.12
R7225:Tshz3 UTSW 7 36769657 missense probably damaging 1.00
R7238:Tshz3 UTSW 7 36770097 missense probably damaging 1.00
X0067:Tshz3 UTSW 7 36768796 missense probably benign 0.19
X0067:Tshz3 UTSW 7 36769321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAACGGCAAAGACATCTG -3'
(R):5'- GTACTTCACATTGGCCAGCC -3'

Sequencing Primer
(F):5'- AAGACATCTGCCGTCGTATC -3'
(R):5'- CTGATGGTGGTCATGGAGAGACC -3'
Posted On2016-09-06