Incidental Mutation 'R5449:1700020D05Rik'
List |< first << previous [record 72 of 32981] next >> last >|
ID429244
Institutional Source Beutler Lab
Gene Symbol 1700020D05Rik
Ensembl Gene ENSMUSG00000100937
Gene NameRIKEN cDNA 1700020D05 gene
Synonyms
MMRRC Submission 043014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R5449 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5502767-5503787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5503264 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 163 (T163M)
Ref Sequence ENSEMBL: ENSMUSP00000140922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070172] [ENSMUST00000189704]
Predicted Effect probably benign
Transcript: ENSMUST00000070172
SMART Domains Protein: ENSMUSP00000070915
Gene: ENSMUSG00000056185

DomainStartEndE-ValueType
Pfam:PX 24 165 1.4e-19 PFAM
Pfam:Vps5 183 394 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189704
AA Change: T163M

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140922
Gene: ENSMUSG00000100937
AA Change: T163M

DomainStartEndE-ValueType
Pfam:MAGE 82 253 2.2e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,266,382 I98F probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A630010A05Rik A G 16: 14,618,673 K197E possibly damaging Het
Agrn A G 4: 156,167,280 probably null Het
Atad5 A G 11: 80,124,108 I1337V probably damaging Het
Cd44 T C 2: 102,832,546 T550A probably damaging Het
Cdk5rap2 A C 4: 70,276,651 L952V probably benign Het
Cep104 T A 4: 153,985,305 probably null Het
Cfl1 A G 19: 5,493,493 *167W probably null Het
Col22a1 T C 15: 71,821,949 D734G unknown Het
Cry1 G A 10: 85,133,135 L581F probably benign Het
Dmpk A G 7: 19,090,991 D406G probably benign Het
Faah T C 4: 115,999,495 probably null Het
Fchsd2 T C 7: 101,277,524 F607S probably damaging Het
Fga CAAAG CAAAGAAAG 3: 83,030,862 probably null Het
Hdac5 G A 11: 102,196,097 Q46* probably null Het
Hltf A G 3: 20,069,083 T212A possibly damaging Het
Ilvbl G A 10: 78,577,028 probably null Het
Ldhc T C 7: 46,869,658 S102P possibly damaging Het
Med12l T C 3: 59,259,706 V1529A probably damaging Het
Nlrp9a A G 7: 26,557,829 I202V probably benign Het
Pdc A C 1: 150,333,439 L224F probably damaging Het
Pgr T C 9: 8,956,343 V764A possibly damaging Het
Plxna1 T C 6: 89,323,608 D1578G probably damaging Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Ptrh1 A G 2: 32,776,346 S37G probably damaging Het
Rgs9 T C 11: 109,225,744 D411G probably benign Het
Riok3 A T 18: 12,155,246 E493D probably damaging Het
Rnf213 T C 11: 119,415,076 M570T probably benign Het
Scamp2 A G 9: 57,580,871 D187G probably damaging Het
Scn1a T A 2: 66,321,002 I819F probably damaging Het
Slc7a5 C A 8: 121,886,348 W330C probably damaging Het
Syn3 A T 10: 86,351,570 F230Y probably damaging Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Tro T C X: 150,645,970 probably benign Het
Ubr1 T A 2: 120,963,500 M68L probably benign Het
Vmn1r120 A C 7: 21,053,149 H212Q possibly damaging Het
Vmn1r46 T C 6: 89,976,361 V64A probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp384 T C 6: 125,024,138 S58P probably damaging Het
Other mutations in 1700020D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:1700020D05Rik APN 19 5503181 missense possibly damaging 0.46
IGL03285:1700020D05Rik APN 19 5503177 missense probably damaging 1.00
R4445:1700020D05Rik UTSW 19 5502994 missense probably damaging 1.00
R4804:1700020D05Rik UTSW 19 5503000 missense possibly damaging 0.82
R5542:1700020D05Rik UTSW 19 5503435 missense probably damaging 0.99
R6435:1700020D05Rik UTSW 19 5503418 missense probably benign 0.06
R6476:1700020D05Rik UTSW 19 5503225 missense probably damaging 1.00
R6764:1700020D05Rik UTSW 19 5502872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGATCTGTGTGGGGTATCC -3'
(R):5'- TCATGAAACATGTCGTCCGAG -3'

Sequencing Primer
(F):5'- CAGGTAACGCTGTTTCACGAAGTC -3'
(R):5'- TGAAACATGTCGTCCGAGACTAC -3'
Posted On2016-09-06