Incidental Mutation 'R5450:Hc'
ID429254
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35013038 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1067 (D1067G)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure
Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028233
AA Change: D1067G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: D1067G

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153559
Predicted Effect probably benign
Transcript: ENSMUST00000156412
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Catsperb A T 12: 101,446,068 H138L possibly damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Eral1 C T 11: 78,078,357 D106N probably benign Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Ikzf3 C T 11: 98,467,086 R475H probably damaging Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Mx1 A T 16: 97,454,147 Y235* probably null Het
Olfr1269 A G 2: 90,118,669 *310Q probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc30a5 C T 13: 100,821,172 V130I possibly damaging Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Zfp366 A G 13: 99,229,585 Y418C probably damaging Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 intron probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGTCTGAAGTTAGAAGAACGAG -3'
(R):5'- TCCTCTCTGAATGGGAGCAG -3'

Sequencing Primer
(F):5'- CCACACCTAGATCAGATGTAGTTG -3'
(R):5'- CTCTCTGAATGGGAGCAGAATGTTC -3'
Posted On2016-09-06