Incidental Mutation 'R5450:Catsperb'
ID429295
Institutional Source Beutler Lab
Gene Symbol Catsperb
Ensembl Gene ENSMUSG00000047014
Gene Namecation channel sperm associated auxiliary subunit beta
Synonyms4932415G16Rik
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location101404653-101626009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101446068 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 138 (H138L)
Ref Sequence ENSEMBL: ENSMUSP00000152678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055156
AA Change: H138L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: H138L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Pfam:CATSPERB 569 1088 1.1e-258 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221241
AA Change: H138L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221965
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Eral1 C T 11: 78,078,357 D106N probably benign Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Hc T C 2: 35,013,038 D1067G possibly damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Ikzf3 C T 11: 98,467,086 R475H probably damaging Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Mx1 A T 16: 97,454,147 Y235* probably null Het
Olfr1269 A G 2: 90,118,669 *310Q probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc30a5 C T 13: 100,821,172 V130I possibly damaging Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Zfp366 A G 13: 99,229,585 Y418C probably damaging Het
Other mutations in Catsperb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Catsperb APN 12 101463119 missense probably damaging 1.00
IGL00580:Catsperb APN 12 101591529 missense probably benign 0.01
IGL00661:Catsperb APN 12 101588098 missense probably damaging 1.00
IGL00979:Catsperb APN 12 101415325 missense probably benign 0.34
IGL01154:Catsperb APN 12 101625681 missense possibly damaging 0.79
IGL01360:Catsperb APN 12 101625254 missense probably damaging 1.00
IGL01607:Catsperb APN 12 101480726 splice site probably benign
IGL01679:Catsperb APN 12 101591582 splice site probably null
IGL01827:Catsperb APN 12 101591540 missense probably benign 0.00
IGL01866:Catsperb APN 12 101509311 nonsense probably null
IGL02161:Catsperb APN 12 101409415 splice site probably benign
IGL02177:Catsperb APN 12 101541462 missense probably damaging 1.00
IGL02618:Catsperb APN 12 101480724 splice site probably benign
IGL02721:Catsperb APN 12 101625297 missense probably null 1.00
IGL02828:Catsperb APN 12 101480782 missense probably benign 0.00
R0571:Catsperb UTSW 12 101602774 missense possibly damaging 0.72
R0727:Catsperb UTSW 12 101594355 splice site probably null
R0842:Catsperb UTSW 12 101463048 missense probably damaging 1.00
R1187:Catsperb UTSW 12 101625732 missense probably benign 0.07
R1432:Catsperb UTSW 12 101622217 missense probably damaging 1.00
R1449:Catsperb UTSW 12 101588197 missense probably benign 0.09
R1488:Catsperb UTSW 12 101594267 missense probably damaging 0.97
R1540:Catsperb UTSW 12 101412330 missense probably benign 0.02
R1560:Catsperb UTSW 12 101625726 missense probably benign 0.01
R1563:Catsperb UTSW 12 101588102 missense probably damaging 1.00
R1583:Catsperb UTSW 12 101463114 missense probably damaging 0.96
R1989:Catsperb UTSW 12 101602711 missense probably damaging 1.00
R1993:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R1995:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R2037:Catsperb UTSW 12 101507962 missense probably damaging 1.00
R2186:Catsperb UTSW 12 101480782 missense probably benign 0.00
R2217:Catsperb UTSW 12 101594219 missense probably damaging 0.99
R2391:Catsperb UTSW 12 101624706 missense probably damaging 1.00
R2679:Catsperb UTSW 12 101463145 missense probably damaging 1.00
R3848:Catsperb UTSW 12 101509326 missense probably damaging 0.98
R4023:Catsperb UTSW 12 101602683 nonsense probably null
R4507:Catsperb UTSW 12 101480828 critical splice donor site probably null
R4558:Catsperb UTSW 12 101591540 missense possibly damaging 0.94
R4649:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4651:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4866:Catsperb UTSW 12 101507949 missense probably damaging 1.00
R4873:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4875:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4897:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5002:Catsperb UTSW 12 101520554 missense probably benign
R5137:Catsperb UTSW 12 101549811 missense probably damaging 0.96
R5396:Catsperb UTSW 12 101594284 missense possibly damaging 0.90
R5484:Catsperb UTSW 12 101575916 missense probably benign 0.38
R5846:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5905:Catsperb UTSW 12 101602700 missense possibly damaging 0.69
R5906:Catsperb UTSW 12 101510462 missense probably damaging 1.00
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6149:Catsperb UTSW 12 101549839 missense probably damaging 1.00
R6165:Catsperb UTSW 12 101575816 missense possibly damaging 0.90
R6210:Catsperb UTSW 12 101412568 intron probably null
R6297:Catsperb UTSW 12 101591396 unclassified probably null
R6302:Catsperb UTSW 12 101588143 missense possibly damaging 0.95
R6681:Catsperb UTSW 12 101624735 nonsense probably null
R6698:Catsperb UTSW 12 101509207 missense probably damaging 1.00
R6869:Catsperb UTSW 12 101480737 missense probably benign 0.09
R6948:Catsperb UTSW 12 101481068 missense probably benign 0.00
R7035:Catsperb UTSW 12 101415334 missense probably damaging 1.00
R7073:Catsperb UTSW 12 101509238 missense probably benign 0.09
R7100:Catsperb UTSW 12 101446038 missense possibly damaging 0.83
R7338:Catsperb UTSW 12 101480984 missense probably benign 0.08
R7397:Catsperb UTSW 12 101588023 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ATACCCCTTAACAAAATGGTTATGC -3'
(R):5'- TGGTACACTTGCATATATGTACACAAC -3'

Sequencing Primer
(F):5'- CCCTTAACAAAATGGTTATGCATTTC -3'
(R):5'- CTTGCATATATGTACACAACACAATC -3'
Posted On2016-09-06