Incidental Mutation 'R5450:Mx1'
ID429307
Institutional Source Beutler Lab
Gene Symbol Mx1
Ensembl Gene ENSMUSG00000000386
Gene NameMX dynamin-like GTPase 1
SynonymsMx-1, Mx, myxovirus (influenza) resistance 1 polypeptide
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97447035-97462907 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 97454147 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 235 (Y235*)
Ref Sequence ENSEMBL: ENSMUSP00000156203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023655] [ENSMUST00000113768] [ENSMUST00000135184] [ENSMUST00000142883] [ENSMUST00000155233] [ENSMUST00000232193] [ENSMUST00000232282]
Predicted Effect probably null
Transcript: ENSMUST00000023655
AA Change: Y235*
SMART Domains Protein: ENSMUSP00000023655
Gene: ENSMUSG00000000386
AA Change: Y235*

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
low complexity region 309 325 N/A INTRINSIC
Pfam:Dynamin_M 428 509 8.1e-12 PFAM
GED 534 625 5.58e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113768
SMART Domains Protein: ENSMUSP00000109397
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 12 241 1.34e-98 SMART
low complexity region 279 289 N/A INTRINSIC
GED 304 395 5.58e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135184
AA Change: Y91*
SMART Domains Protein: ENSMUSP00000138813
Gene: ENSMUSG00000000386
AA Change: Y91*

DomainStartEndE-ValueType
DYNc 2 111 2.62e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142883
SMART Domains Protein: ENSMUSP00000114709
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
Pfam:Dynamin_N 39 65 1.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155233
AA Change: Y235*
SMART Domains Protein: ENSMUSP00000138532
Gene: ENSMUSG00000000386
AA Change: Y235*

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231995
Predicted Effect probably benign
Transcript: ENSMUST00000232193
Predicted Effect probably null
Transcript: ENSMUST00000232282
AA Change: Y235*
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: This gene encodes a member of the Mx protein family of large GTPases, and functions in the innate immunity system. Interferon alpha/beta treatment or viral infection induces expression of this protein, which subsequently accumulates in the cytoplasm and inhibits viral replication. It has been shown to confer resistance to the influenza virus. This gene produces a functional protein in some feral mouse strains, whereas some inbred mouse strains including the strain of the reference genome, C57BL/6J, contain a deletion or a nonsense mutation that results in a non-functional gene product. [provided by RefSeq, Aug 2015]
PHENOTYPE: A2G, SL/NiA, T9 and CAST/Ei strains produce the MX1 protein (Mx1+ allele) conferring resistance to myxoviruses, whereas no protein is made by the Mx1- susceptible alleles of C57BL/6J and many other inbred strains with an exon 9-11 deletion; or CBA/J, CE/J, I/LnJ and PERA/Ei with a nonsense mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Catsperb A T 12: 101,446,068 H138L possibly damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Eral1 C T 11: 78,078,357 D106N probably benign Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Hc T C 2: 35,013,038 D1067G possibly damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Ikzf3 C T 11: 98,467,086 R475H probably damaging Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Olfr1269 A G 2: 90,118,669 *310Q probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc30a5 C T 13: 100,821,172 V130I possibly damaging Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Zfp366 A G 13: 99,229,585 Y418C probably damaging Het
Other mutations in Mx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Mx1 APN 16 97457432 missense probably damaging 1.00
IGL01328:Mx1 APN 16 97455632 missense probably damaging 0.99
IGL03105:Mx1 APN 16 97456354 missense possibly damaging 0.94
PIT4585001:Mx1 UTSW 16 97456254 missense probably benign 0.07
R0003:Mx1 UTSW 16 97451588 intron probably benign
R1597:Mx1 UTSW 16 97455129 missense probably damaging 1.00
R1753:Mx1 UTSW 16 97454158 missense probably damaging 1.00
R1780:Mx1 UTSW 16 97451512 makesense probably null
R1826:Mx1 UTSW 16 97455637 missense possibly damaging 0.95
R1851:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R1852:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R2059:Mx1 UTSW 16 97454179 nonsense probably null
R2223:Mx1 UTSW 16 97455232 splice site probably benign
R3441:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3442:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3782:Mx1 UTSW 16 97451995 missense possibly damaging 0.75
R4460:Mx1 UTSW 16 97454081 missense probably damaging 0.99
R4659:Mx1 UTSW 16 97455239 splice site probably null
R5116:Mx1 UTSW 16 97457479 missense possibly damaging 0.67
R5186:Mx1 UTSW 16 97455494 missense probably benign 0.09
R5215:Mx1 UTSW 16 97448360 missense possibly damaging 0.72
R5249:Mx1 UTSW 16 97457428 missense probably damaging 1.00
R5806:Mx1 UTSW 16 97454151 missense possibly damaging 0.81
R5894:Mx1 UTSW 16 97454206 missense probably damaging 1.00
R5916:Mx1 UTSW 16 97451733 missense probably benign 0.00
R5981:Mx1 UTSW 16 97454205 missense probably damaging 1.00
R7111:Mx1 UTSW 16 97455176 missense probably damaging 0.99
R7207:Mx1 UTSW 16 97452198 missense probably benign
R7238:Mx1 UTSW 16 97448296 missense unknown
R7318:Mx1 UTSW 16 97452086 missense probably benign 0.06
X0028:Mx1 UTSW 16 97450421 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAATGCGCTGGTCAATTGG -3'
(R):5'- ATGGGAAGAAGCCTTGTGC -3'

Sequencing Primer
(F):5'- ACACAATGTCAGGCCTGTTC -3'
(R):5'- CCTTGTGCTGCTGGTGGC -3'
Posted On2016-09-06