Incidental Mutation 'R5366:Soat1'
ID429317
Institutional Source Beutler Lab
Gene Symbol Soat1
Ensembl Gene ENSMUSG00000026600
Gene Namesterol O-acyltransferase 1
SynonymsACAT-1, 8430426K15Rik, Acact, hid
MMRRC Submission 042944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5366 (G1)
Quality Score169
Status Validated
Chromosome1
Chromosomal Location156424525-156474331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156444611 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 101 (D101E)
Ref Sequence ENSEMBL: ENSMUSP00000140721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051396] [ENSMUST00000187507] [ENSMUST00000188027] [ENSMUST00000189661]
Predicted Effect probably benign
Transcript: ENSMUST00000051396
AA Change: D101E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000058344
Gene: ENSMUSG00000026600
AA Change: D101E

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 3.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187073
Predicted Effect probably benign
Transcript: ENSMUST00000187507
AA Change: D68E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139431
Gene: ENSMUSG00000026600
AA Change: D68E

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 141 160 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188027
Predicted Effect probably benign
Transcript: ENSMUST00000189661
AA Change: D101E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140721
Gene: ENSMUSG00000026600
AA Change: D101E

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 1.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191379
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mutants producing no protein or a truncated protein show depletion of cholesterol esters in adrenal cortex and peritoneal macrophages. Additionally, null mutants have reduced eye openings due to atrophy of meibomian glands or abnromal morphology and arrangement of medullary cells of all hair types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,242,288 M657K possibly damaging Het
4932431P20Rik A C 7: 29,533,539 noncoding transcript Het
Abcb5 T C 12: 118,867,930 N1229S possibly damaging Het
Adgre1 G A 17: 57,402,817 C158Y probably benign Het
Ahnak T A 19: 9,016,735 S5128T possibly damaging Het
Ankrd36 T A 11: 5,592,841 C322* probably null Het
Ano1 T A 7: 144,654,209 T113S possibly damaging Het
Apeh A T 9: 108,091,806 S321T probably benign Het
Atg4d T A 9: 21,268,652 V273D probably damaging Het
Cacna2d4 A G 6: 119,274,318 D489G probably damaging Het
Cd47 T C 16: 49,896,373 F256L probably damaging Het
Cd84 A T 1: 171,873,305 D211V probably damaging Het
Cfap46 A G 7: 139,650,886 L942P probably damaging Het
Cfh A C 1: 140,136,235 C434W probably damaging Het
Chst2 T C 9: 95,405,465 D276G probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Degs1 C A 1: 182,279,362 D111Y probably benign Het
Dhps T A 8: 85,074,784 D313E probably damaging Het
Dock9 A G 14: 121,578,203 C1645R probably damaging Het
Efcab7 A C 4: 99,904,734 D407A possibly damaging Het
Eif3a G T 19: 60,779,533 T189N probably benign Het
Ep300 T A 15: 81,616,100 L57M probably benign Het
Exoc6b T A 6: 84,890,531 I300L probably benign Het
Fam69c T A 18: 84,730,595 L106Q probably damaging Het
Fzd8 T C 18: 9,213,880 S321P probably damaging Het
Gm9920 T A 15: 55,112,309 probably benign Het
Gucy2c A G 6: 136,720,741 I668T probably damaging Het
Irgc1 C T 7: 24,433,426 probably benign Het
Jsrp1 G T 10: 80,810,196 S143* probably null Het
Kctd4 T C 14: 75,962,819 Y77H probably damaging Het
Klhdc1 T A 12: 69,283,150 I351N probably damaging Het
Klra17 C T 6: 129,874,895 E5K possibly damaging Het
Mapk8 A T 14: 33,390,729 V211E probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrc1 T C 2: 14,321,914 Y1208H probably benign Het
Mrps16 A T 14: 20,391,455 S94T probably benign Het
Muc5ac A G 7: 141,807,550 T1533A probably benign Het
Myh10 A T 11: 68,760,692 D287V probably damaging Het
Obscn T C 11: 59,080,260 T2476A probably damaging Het
Olfm2 T A 9: 20,668,412 T356S probably benign Het
Olfr1313 T C 2: 112,072,478 Y35C possibly damaging Het
P2rx2 T A 5: 110,341,828 N108I probably damaging Het
Pbx4 A T 8: 69,870,170 T309S probably benign Het
Phyhip C A 14: 70,466,855 H171Q probably benign Het
Pou4f3 A G 18: 42,395,754 E254G probably damaging Het
Pxdn C A 12: 30,002,900 H845Q probably damaging Het
Rgcc T C 14: 79,291,683 T111A probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sgsm1 C A 5: 113,251,039 E722D possibly damaging Het
Spag5 T A 11: 78,320,326 probably null Het
Spata31 A T 13: 64,920,459 E140D probably damaging Het
Srrm2 T A 17: 23,818,704 S1537T probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tbc1d4 G T 14: 101,607,976 T162K possibly damaging Het
Tmem163 A C 1: 127,500,305 probably benign Het
Tmem43 T C 6: 91,478,258 V72A probably benign Het
Tmprss11c G A 5: 86,282,134 T24I possibly damaging Het
Trerf1 A T 17: 47,315,190 noncoding transcript Het
Trim44 A G 2: 102,400,131 L185P probably damaging Het
Tspyl1 A G 10: 34,282,345 D22G possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyro3 G A 2: 119,804,831 R201Q probably damaging Het
Ubxn2a T A 12: 4,880,741 K206N probably benign Het
Usp17lb G T 7: 104,840,408 H436Q possibly damaging Het
Vps9d1 A G 8: 123,245,114 I584T possibly damaging Het
Vrk1 T A 12: 106,055,819 M131K possibly damaging Het
Zfp827 A T 8: 79,185,704 K986N possibly damaging Het
Zswim4 A G 8: 84,212,790 M821T probably benign Het
Other mutations in Soat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Soat1 APN 1 156466730 missense probably benign 0.37
IGL00840:Soat1 APN 1 156434196 missense probably damaging 1.00
IGL00980:Soat1 APN 1 156441341 missense probably benign 0.00
IGL02032:Soat1 APN 1 156440575 missense probably benign 0.00
IGL02177:Soat1 APN 1 156440503 splice site probably benign
IGL02718:Soat1 APN 1 156441429 missense probably benign 0.02
IGL02756:Soat1 APN 1 156446575 missense probably benign
IGL02884:Soat1 APN 1 156441356 missense possibly damaging 0.88
R0309:Soat1 UTSW 1 156442453 missense probably damaging 1.00
R0315:Soat1 UTSW 1 156440513 nonsense probably null
R0492:Soat1 UTSW 1 156441354 missense probably benign 0.00
R0519:Soat1 UTSW 1 156441246 missense probably damaging 1.00
R1184:Soat1 UTSW 1 156442374 splice site probably null
R1187:Soat1 UTSW 1 156434175 missense probably damaging 1.00
R1310:Soat1 UTSW 1 156441332 missense possibly damaging 0.92
R1378:Soat1 UTSW 1 156466782 utr 5 prime probably benign
R1547:Soat1 UTSW 1 156439761 missense probably damaging 0.98
R1690:Soat1 UTSW 1 156444574 missense probably benign
R1771:Soat1 UTSW 1 156442421 missense probably benign
R1776:Soat1 UTSW 1 156442421 missense probably benign
R2264:Soat1 UTSW 1 156437697 splice site probably benign
R2483:Soat1 UTSW 1 156431099 missense probably damaging 1.00
R4838:Soat1 UTSW 1 156432937 missense probably benign 0.05
R4863:Soat1 UTSW 1 156432328 missense probably damaging 0.98
R5828:Soat1 UTSW 1 156437748 missense probably benign 0.01
R6381:Soat1 UTSW 1 156435803 missense probably damaging 0.99
R6583:Soat1 UTSW 1 156466492 intron probably null
R7085:Soat1 UTSW 1 156432331 missense not run
Predicted Primers PCR Primer
(F):5'- TGGATGGGTGGATGACGGAC -3'
(R):5'- TAGGGCTTCAGTTAGGTATCTGA -3'

Sequencing Primer
(F):5'- TGGATGACGGACGGACAG -3'
(R):5'- CTCATGGGAGCAAGTTTC -3'
Posted On2016-09-06