Mutagenetix > Incidental Mutation

Incidental Mutation 'R5366:Mrc1'

429319

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

042944-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R5366 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14326725 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1208 (Y1208H)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028045
AA Change: Y1208H

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: Y1208H

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Meta Mutation Damage Score

0.1152

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	C	12: 118,831,665 (GRCm39)	N1229S	possibly damaging	Het
Adgre1	G	A	17: 57,709,817 (GRCm39)	C158Y	probably benign	Het
Ahnak	T	A	19: 8,994,099 (GRCm39)	S5128T	possibly damaging	Het
Ankrd36	T	A	11: 5,542,841 (GRCm39)	C322*	probably null	Het
Ano1	T	A	7: 144,207,946 (GRCm39)	T113S	possibly damaging	Het
Apeh	A	T	9: 107,969,005 (GRCm39)	S321T	probably benign	Het
Atg4d	T	A	9: 21,179,948 (GRCm39)	V273D	probably damaging	Het
Cacna2d4	A	G	6: 119,251,279 (GRCm39)	D489G	probably damaging	Het
Cd47	T	C	16: 49,716,736 (GRCm39)	F256L	probably damaging	Het
Cd84	A	T	1: 171,700,872 (GRCm39)	D211V	probably damaging	Het
Cfap46	A	G	7: 139,230,802 (GRCm39)	L942P	probably damaging	Het
Cfh	A	C	1: 140,063,973 (GRCm39)	C434W	probably damaging	Het
Chst2	T	C	9: 95,287,518 (GRCm39)	D276G	probably damaging	Het
Ctsq	T	C	13: 61,184,913 (GRCm39)	T258A	probably benign	Het
Degs1	C	A	1: 182,106,927 (GRCm39)	D111Y	probably benign	Het
Dhps	T	A	8: 85,801,413 (GRCm39)	D313E	probably damaging	Het
Dipk1c	T	A	18: 84,748,720 (GRCm39)	L106Q	probably damaging	Het
Dock9	A	G	14: 121,815,615 (GRCm39)	C1645R	probably damaging	Het
Efcab7	A	C	4: 99,761,931 (GRCm39)	D407A	possibly damaging	Het
Eif3a	G	T	19: 60,767,971 (GRCm39)	T189N	probably benign	Het
Ep300	T	A	15: 81,500,301 (GRCm39)	L57M	probably benign	Het
Exoc6b	T	A	6: 84,867,513 (GRCm39)	I300L	probably benign	Het
Fzd8	T	C	18: 9,213,880 (GRCm39)	S321P	probably damaging	Het
Garre1	A	T	7: 33,941,713 (GRCm39)	M657K	possibly damaging	Het
Gm9920	T	A	15: 54,975,705 (GRCm39)		probably benign	Het
Gucy2c	A	G	6: 136,697,739 (GRCm39)	I668T	probably damaging	Het
Irgc	C	T	7: 24,132,851 (GRCm39)		probably benign	Het
Jsrp1	G	T	10: 80,646,030 (GRCm39)	S143*	probably null	Het
Kctd4	T	C	14: 76,200,259 (GRCm39)	Y77H	probably damaging	Het
Klhdc1	T	A	12: 69,329,924 (GRCm39)	I351N	probably damaging	Het
Klra17	C	T	6: 129,851,858 (GRCm39)	E5K	possibly damaging	Het
Mapk8	A	T	14: 33,112,686 (GRCm39)	V211E	probably damaging	Het
Mdn1	C	T	4: 32,723,690 (GRCm39)	P2542L	probably damaging	Het
Mrps16	A	T	14: 20,441,523 (GRCm39)	S94T	probably benign	Het
Muc5ac	A	G	7: 141,361,287 (GRCm39)	T1533A	probably benign	Het
Myh10	A	T	11: 68,651,518 (GRCm39)	D287V	probably damaging	Het
Obscn	T	C	11: 58,971,086 (GRCm39)	T2476A	probably damaging	Het
Olfm2	T	A	9: 20,579,708 (GRCm39)	T356S	probably benign	Het
Or4f60	T	C	2: 111,902,823 (GRCm39)	Y35C	possibly damaging	Het
P2rx2	T	A	5: 110,489,694 (GRCm39)	N108I	probably damaging	Het
Pbx4	A	T	8: 70,322,820 (GRCm39)	T309S	probably benign	Het
Phyhip	C	A	14: 70,704,295 (GRCm39)	H171Q	probably benign	Het
Pou4f3	A	G	18: 42,528,819 (GRCm39)	E254G	probably damaging	Het
Pxdn	C	A	12: 30,052,899 (GRCm39)	H845Q	probably damaging	Het
Rgcc	T	C	14: 79,529,123 (GRCm39)	T111A	probably benign	Het
Rptor	G	A	11: 119,734,539 (GRCm39)	G514D	probably damaging	Het
Scara5	CG	C	14: 65,997,111 (GRCm39)		probably null	Het
Sgsm1	C	A	5: 113,398,905 (GRCm39)	E722D	possibly damaging	Het
Soat1	A	T	1: 156,272,181 (GRCm39)	D101E	probably benign	Het
Spag5	T	A	11: 78,211,152 (GRCm39)		probably null	Het
Spata31	A	T	13: 65,068,273 (GRCm39)	E140D	probably damaging	Het
Srrm2	T	A	17: 24,037,678 (GRCm39)	S1537T	probably benign	Het
Stam2	G	A	2: 52,626,305 (GRCm39)		probably benign	Het
Tbc1d4	G	T	14: 101,845,412 (GRCm39)	T162K	possibly damaging	Het
Tmem163	A	C	1: 127,428,042 (GRCm39)		probably benign	Het
Tmem43	T	C	6: 91,455,240 (GRCm39)	V72A	probably benign	Het
Tmprss11c	G	A	5: 86,429,993 (GRCm39)	T24I	possibly damaging	Het
Trerf1	A	T	17: 47,626,116 (GRCm39)		noncoding transcript	Het
Trim44	A	G	2: 102,230,476 (GRCm39)	L185P	probably damaging	Het
Tspyl1	A	G	10: 34,158,341 (GRCm39)	D22G	possibly damaging	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Tyro3	G	A	2: 119,635,312 (GRCm39)	R201Q	probably damaging	Het
Ubxn2a	T	A	12: 4,930,741 (GRCm39)	K206N	probably benign	Het
Usp17lb	G	T	7: 104,489,615 (GRCm39)	H436Q	possibly damaging	Het
Vps9d1	A	G	8: 123,971,853 (GRCm39)	I584T	possibly damaging	Het
Vrk1	T	A	12: 106,022,078 (GRCm39)	M131K	possibly damaging	Het
Wdr87-ps	A	C	7: 29,232,964 (GRCm39)		noncoding transcript	Het
Zfp827	A	T	8: 79,912,333 (GRCm39)	K986N	possibly damaging	Het
Zswim4	A	G	8: 84,939,419 (GRCm39)	M821T	probably benign	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0613:Mrc1	UTSW	2	14,299,630 (GRCm39)	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1122:Mrc1	UTSW	2	14,266,147 (GRCm39)	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14,313,544 (GRCm39)	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14,326,584 (GRCm39)	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14,330,183 (GRCm39)	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14,293,793 (GRCm39)	splice site	probably benign
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14,333,383 (GRCm39)	nonsense	probably null
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6631:Mrc1	UTSW	2	14,243,296 (GRCm39)	missense	probably benign
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGCTTTCTGTGAGAAGGAG -3'
(R):5'- ATCATTTCGACCTGTGCATATTGG -3'

Sequencing Primer
(F):5'- AGGACTGAAGTGTCATGCTTG -3'
(R):5'- GCATATTGGTTGATAGCCAGCTCC -3'

Posted On

2016-09-06