Incidental Mutation 'R5366:Olfm2'
ID429348
Institutional Source Beutler Lab
Gene Symbol Olfm2
Ensembl Gene ENSMUSG00000032172
Gene Nameolfactomedin 2
SynonymsA030009A06Rik
MMRRC Submission 042944-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5366 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20667690-20746349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20668412 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 356 (T356S)
Ref Sequence ENSEMBL: ENSMUSP00000149231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034689] [ENSMUST00000034692] [ENSMUST00000215999] [ENSMUST00000217198]
Predicted Effect probably benign
Transcript: ENSMUST00000034689
SMART Domains Protein: ENSMUSP00000034689
Gene: ENSMUSG00000032171

DomainStartEndE-ValueType
WW 6 39 3.57e-14 SMART
Pfam:Rotamase_3 45 165 1.6e-23 PFAM
Pfam:Rotamase 61 165 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034692
AA Change: T348S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034692
Gene: ENSMUSG00000032172
AA Change: T348S

DomainStartEndE-ValueType
Pfam:Noelin-1 19 118 3.8e-44 PFAM
Blast:OLF 132 177 2e-18 BLAST
OLF 190 440 4.32e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215039
Predicted Effect probably benign
Transcript: ENSMUST00000215999
AA Change: T356S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217198
AA Change: T378S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (77/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate locomotor and anxiety-related behavioral abnormalities, altered visual evoked potential, and reduced compactness of myelin sheaths in the optic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,242,288 M657K possibly damaging Het
4932431P20Rik A C 7: 29,533,539 noncoding transcript Het
Abcb5 T C 12: 118,867,930 N1229S possibly damaging Het
Adgre1 G A 17: 57,402,817 C158Y probably benign Het
Ahnak T A 19: 9,016,735 S5128T possibly damaging Het
Ankrd36 T A 11: 5,592,841 C322* probably null Het
Ano1 T A 7: 144,654,209 T113S possibly damaging Het
Apeh A T 9: 108,091,806 S321T probably benign Het
Atg4d T A 9: 21,268,652 V273D probably damaging Het
Cacna2d4 A G 6: 119,274,318 D489G probably damaging Het
Cd47 T C 16: 49,896,373 F256L probably damaging Het
Cd84 A T 1: 171,873,305 D211V probably damaging Het
Cfap46 A G 7: 139,650,886 L942P probably damaging Het
Cfh A C 1: 140,136,235 C434W probably damaging Het
Chst2 T C 9: 95,405,465 D276G probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Degs1 C A 1: 182,279,362 D111Y probably benign Het
Dhps T A 8: 85,074,784 D313E probably damaging Het
Dock9 A G 14: 121,578,203 C1645R probably damaging Het
Efcab7 A C 4: 99,904,734 D407A possibly damaging Het
Eif3a G T 19: 60,779,533 T189N probably benign Het
Ep300 T A 15: 81,616,100 L57M probably benign Het
Exoc6b T A 6: 84,890,531 I300L probably benign Het
Fam69c T A 18: 84,730,595 L106Q probably damaging Het
Fzd8 T C 18: 9,213,880 S321P probably damaging Het
Gm9920 T A 15: 55,112,309 probably benign Het
Gucy2c A G 6: 136,720,741 I668T probably damaging Het
Irgc1 C T 7: 24,433,426 probably benign Het
Jsrp1 G T 10: 80,810,196 S143* probably null Het
Kctd4 T C 14: 75,962,819 Y77H probably damaging Het
Klhdc1 T A 12: 69,283,150 I351N probably damaging Het
Klra17 C T 6: 129,874,895 E5K possibly damaging Het
Mapk8 A T 14: 33,390,729 V211E probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrc1 T C 2: 14,321,914 Y1208H probably benign Het
Mrps16 A T 14: 20,391,455 S94T probably benign Het
Muc5ac A G 7: 141,807,550 T1533A probably benign Het
Myh10 A T 11: 68,760,692 D287V probably damaging Het
Obscn T C 11: 59,080,260 T2476A probably damaging Het
Olfr1313 T C 2: 112,072,478 Y35C possibly damaging Het
P2rx2 T A 5: 110,341,828 N108I probably damaging Het
Pbx4 A T 8: 69,870,170 T309S probably benign Het
Phyhip C A 14: 70,466,855 H171Q probably benign Het
Pou4f3 A G 18: 42,395,754 E254G probably damaging Het
Pxdn C A 12: 30,002,900 H845Q probably damaging Het
Rgcc T C 14: 79,291,683 T111A probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sgsm1 C A 5: 113,251,039 E722D possibly damaging Het
Soat1 A T 1: 156,444,611 D101E probably benign Het
Spag5 T A 11: 78,320,326 probably null Het
Spata31 A T 13: 64,920,459 E140D probably damaging Het
Srrm2 T A 17: 23,818,704 S1537T probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tbc1d4 G T 14: 101,607,976 T162K possibly damaging Het
Tmem163 A C 1: 127,500,305 probably benign Het
Tmem43 T C 6: 91,478,258 V72A probably benign Het
Tmprss11c G A 5: 86,282,134 T24I possibly damaging Het
Trerf1 A T 17: 47,315,190 noncoding transcript Het
Trim44 A G 2: 102,400,131 L185P probably damaging Het
Tspyl1 A G 10: 34,282,345 D22G possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyro3 G A 2: 119,804,831 R201Q probably damaging Het
Ubxn2a T A 12: 4,880,741 K206N probably benign Het
Usp17lb G T 7: 104,840,408 H436Q possibly damaging Het
Vps9d1 A G 8: 123,245,114 I584T possibly damaging Het
Vrk1 T A 12: 106,055,819 M131K possibly damaging Het
Zfp827 A T 8: 79,185,704 K986N possibly damaging Het
Zswim4 A G 8: 84,212,790 M821T probably benign Het
Other mutations in Olfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Olfm2 APN 9 20672180 missense probably damaging 1.00
IGL03276:Olfm2 APN 9 20668787 splice site probably benign
IGL03352:Olfm2 APN 9 20668723 missense probably damaging 1.00
R0015:Olfm2 UTSW 9 20668741 missense probably damaging 1.00
R0847:Olfm2 UTSW 9 20668657 missense probably damaging 1.00
R1051:Olfm2 UTSW 9 20668463 missense probably damaging 1.00
R3730:Olfm2 UTSW 9 20672767 missense probably damaging 1.00
R5665:Olfm2 UTSW 9 20668544 unclassified probably null
R5986:Olfm2 UTSW 9 20675650 missense probably damaging 1.00
R6046:Olfm2 UTSW 9 20668528 missense probably damaging 1.00
R6709:Olfm2 UTSW 9 20672713 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAATCCAGCATCGAGATGTG -3'
(R):5'- TCAAGTACCACTTCCGGTCC -3'

Sequencing Primer
(F):5'- CCAGCATCGAGATGTGCGAATAC -3'
(R):5'- ACTTCCGGTCCCGCTCG -3'
Posted On2016-09-06