Incidental Mutation 'R5366:Ankrd36'
ID429354
Institutional Source Beutler Lab
Gene Symbol Ankrd36
Ensembl Gene ENSMUSG00000020481
Gene Nameankyrin repeat domain 36
Synonyms1700012M14Rik, 1700008J08Rik, GC3
MMRRC Submission 042944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.025) question?
Stock #R5366 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5569684-5689337 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5592841 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 322 (C322*)
Ref Sequence ENSEMBL: ENSMUSP00000122397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109856] [ENSMUST00000118112]
Predicted Effect probably benign
Transcript: ENSMUST00000109856
SMART Domains Protein: ENSMUSP00000105482
Gene: ENSMUSG00000020481

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 4.5e-3 SMART
ANK 99 128 1.44e-1 SMART
ANK 132 161 4.6e0 SMART
ANK 165 194 2.48e-5 SMART
ANK 198 227 4.67e-1 SMART
internal_repeat_1 449 555 1.04e-5 PROSPERO
internal_repeat_1 891 981 1.04e-5 PROSPERO
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1268 1297 N/A INTRINSIC
coiled coil region 1318 1338 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118112
AA Change: C322*
SMART Domains Protein: ENSMUSP00000122397
Gene: ENSMUSG00000020481
AA Change: C322*

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 2.9e-5 SMART
ANK 99 128 9.4e-4 SMART
ANK 132 161 2.9e-2 SMART
ANK 165 194 1.5e-7 SMART
ANK 198 227 2.9e-3 SMART
internal_repeat_1 255 352 8.15e-5 PROSPERO
internal_repeat_1 438 538 8.15e-5 PROSPERO
low complexity region 1138 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,242,288 M657K possibly damaging Het
4932431P20Rik A C 7: 29,533,539 noncoding transcript Het
Abcb5 T C 12: 118,867,930 N1229S possibly damaging Het
Adgre1 G A 17: 57,402,817 C158Y probably benign Het
Ahnak T A 19: 9,016,735 S5128T possibly damaging Het
Ano1 T A 7: 144,654,209 T113S possibly damaging Het
Apeh A T 9: 108,091,806 S321T probably benign Het
Atg4d T A 9: 21,268,652 V273D probably damaging Het
Cacna2d4 A G 6: 119,274,318 D489G probably damaging Het
Cd47 T C 16: 49,896,373 F256L probably damaging Het
Cd84 A T 1: 171,873,305 D211V probably damaging Het
Cfap46 A G 7: 139,650,886 L942P probably damaging Het
Cfh A C 1: 140,136,235 C434W probably damaging Het
Chst2 T C 9: 95,405,465 D276G probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Degs1 C A 1: 182,279,362 D111Y probably benign Het
Dhps T A 8: 85,074,784 D313E probably damaging Het
Dock9 A G 14: 121,578,203 C1645R probably damaging Het
Efcab7 A C 4: 99,904,734 D407A possibly damaging Het
Eif3a G T 19: 60,779,533 T189N probably benign Het
Ep300 T A 15: 81,616,100 L57M probably benign Het
Exoc6b T A 6: 84,890,531 I300L probably benign Het
Fam69c T A 18: 84,730,595 L106Q probably damaging Het
Fzd8 T C 18: 9,213,880 S321P probably damaging Het
Gm9920 T A 15: 55,112,309 probably benign Het
Gucy2c A G 6: 136,720,741 I668T probably damaging Het
Irgc1 C T 7: 24,433,426 probably benign Het
Jsrp1 G T 10: 80,810,196 S143* probably null Het
Kctd4 T C 14: 75,962,819 Y77H probably damaging Het
Klhdc1 T A 12: 69,283,150 I351N probably damaging Het
Klra17 C T 6: 129,874,895 E5K possibly damaging Het
Mapk8 A T 14: 33,390,729 V211E probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrc1 T C 2: 14,321,914 Y1208H probably benign Het
Mrps16 A T 14: 20,391,455 S94T probably benign Het
Muc5ac A G 7: 141,807,550 T1533A probably benign Het
Myh10 A T 11: 68,760,692 D287V probably damaging Het
Obscn T C 11: 59,080,260 T2476A probably damaging Het
Olfm2 T A 9: 20,668,412 T356S probably benign Het
Olfr1313 T C 2: 112,072,478 Y35C possibly damaging Het
P2rx2 T A 5: 110,341,828 N108I probably damaging Het
Pbx4 A T 8: 69,870,170 T309S probably benign Het
Phyhip C A 14: 70,466,855 H171Q probably benign Het
Pou4f3 A G 18: 42,395,754 E254G probably damaging Het
Pxdn C A 12: 30,002,900 H845Q probably damaging Het
Rgcc T C 14: 79,291,683 T111A probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sgsm1 C A 5: 113,251,039 E722D possibly damaging Het
Soat1 A T 1: 156,444,611 D101E probably benign Het
Spag5 T A 11: 78,320,326 probably null Het
Spata31 A T 13: 64,920,459 E140D probably damaging Het
Srrm2 T A 17: 23,818,704 S1537T probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tbc1d4 G T 14: 101,607,976 T162K possibly damaging Het
Tmem163 A C 1: 127,500,305 probably benign Het
Tmem43 T C 6: 91,478,258 V72A probably benign Het
Tmprss11c G A 5: 86,282,134 T24I possibly damaging Het
Trerf1 A T 17: 47,315,190 noncoding transcript Het
Trim44 A G 2: 102,400,131 L185P probably damaging Het
Tspyl1 A G 10: 34,282,345 D22G possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyro3 G A 2: 119,804,831 R201Q probably damaging Het
Ubxn2a T A 12: 4,880,741 K206N probably benign Het
Usp17lb G T 7: 104,840,408 H436Q possibly damaging Het
Vps9d1 A G 8: 123,245,114 I584T possibly damaging Het
Vrk1 T A 12: 106,055,819 M131K possibly damaging Het
Zfp827 A T 8: 79,185,704 K986N possibly damaging Het
Zswim4 A G 8: 84,212,790 M821T probably benign Het
Other mutations in Ankrd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ankrd36 APN 11 5620131 missense probably benign 0.01
IGL01361:Ankrd36 APN 11 5596706 splice site probably benign
IGL01370:Ankrd36 APN 11 5584019 missense probably benign 0.06
IGL01384:Ankrd36 APN 11 5628348 missense probably benign 0.33
IGL01484:Ankrd36 APN 11 5629006 missense possibly damaging 0.90
IGL01524:Ankrd36 APN 11 5635092 missense probably benign
IGL01700:Ankrd36 APN 11 5632198 missense probably benign 0.05
IGL02322:Ankrd36 APN 11 5614619 missense possibly damaging 0.86
IGL02511:Ankrd36 APN 11 5660845 unclassified probably null
IGL02824:Ankrd36 APN 11 5574246 missense possibly damaging 0.67
IGL03204:Ankrd36 APN 11 5584023 missense possibly damaging 0.70
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0304:Ankrd36 UTSW 11 5628981 missense possibly damaging 0.55
R0504:Ankrd36 UTSW 11 5629274 missense probably damaging 0.99
R0550:Ankrd36 UTSW 11 5607429 critical splice donor site probably null
R0563:Ankrd36 UTSW 11 5629322 missense probably benign 0.33
R0891:Ankrd36 UTSW 11 5687316 missense possibly damaging 0.72
R1018:Ankrd36 UTSW 11 5646876 unclassified probably benign
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1558:Ankrd36 UTSW 11 5635329 missense probably damaging 0.99
R1663:Ankrd36 UTSW 11 5620126 missense possibly damaging 0.70
R1682:Ankrd36 UTSW 11 5607143 missense possibly damaging 0.84
R1898:Ankrd36 UTSW 11 5575683 missense probably benign 0.33
R2019:Ankrd36 UTSW 11 5689140 missense probably benign
R2032:Ankrd36 UTSW 11 5628616 missense possibly damaging 0.86
R2084:Ankrd36 UTSW 11 5662378 nonsense probably null
R4097:Ankrd36 UTSW 11 5628703 missense possibly damaging 0.85
R4572:Ankrd36 UTSW 11 5689340 unclassified probably null
R4601:Ankrd36 UTSW 11 5570102 missense probably benign 0.04
R4770:Ankrd36 UTSW 11 5590870 missense possibly damaging 0.73
R4777:Ankrd36 UTSW 11 5607120 missense probably benign
R4894:Ankrd36 UTSW 11 5635332 missense probably damaging 0.98
R5288:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5384:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5385:Ankrd36 UTSW 11 5689340 unclassified probably benign
R6109:Ankrd36 UTSW 11 5628941 missense probably damaging 0.98
R6155:Ankrd36 UTSW 11 5687442 missense probably benign 0.00
R6186:Ankrd36 UTSW 11 5643812 missense possibly damaging 0.81
R6289:Ankrd36 UTSW 11 5628837 missense probably damaging 0.96
R6476:Ankrd36 UTSW 11 5628753 missense probably benign 0.05
R6816:Ankrd36 UTSW 11 5643765 missense possibly damaging 0.66
R6880:Ankrd36 UTSW 11 5628748 missense probably damaging 0.99
R6919:Ankrd36 UTSW 11 5629299 missense probably benign
R7007:Ankrd36 UTSW 11 5689168 missense probably benign 0.00
U24488:Ankrd36 UTSW 11 5630772 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTGTGAGGCATTTTACTGTC -3'
(R):5'- GGACCAGTAAGTTTCACCAGAC -3'

Sequencing Primer
(F):5'- ATGAAGAGCTCCTAATGCCCTGG -3'
(R):5'- AGTAAGTTTCACCAGACCACTCTCTG -3'
Posted On2016-09-06