Incidental Mutation 'R5367:Cpq'
ID429439
Institutional Source Beutler Lab
Gene Symbol Cpq
Ensembl Gene ENSMUSG00000039007
Gene Namecarboxypeptidase Q
Synonyms2610034C17Rik, HLS2, Lal-1, Pgcp, 1190003P12Rik
MMRRC Submission 042945-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R5367 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location33083129-33594552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33213104 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 90 (Y90D)
Ref Sequence ENSEMBL: ENSMUSP00000153768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042167] [ENSMUST00000226483] [ENSMUST00000228737] [ENSMUST00000228916]
Predicted Effect probably benign
Transcript: ENSMUST00000042167
AA Change: Y90D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039046
Gene: ENSMUSG00000039007
AA Change: Y90D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
Pfam:Peptidase_M28 268 457 5.9e-29 PFAM
Pfam:Peptidase_M20 284 457 1.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226483
AA Change: Y90D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226896
Predicted Effect probably benign
Transcript: ENSMUST00000228737
AA Change: Y90D

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228916
AA Change: Y90D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallopeptidase that belongs to the peptidase M28 family. The encoded protein may catalyze the cleavage of dipeptides with unsubstituted terminals into amino acids. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T C 3: 60,039,636 Y252H probably damaging Het
Aadat T C 8: 60,526,596 I164T probably damaging Het
Adam11 A G 11: 102,773,653 H389R probably benign Het
Alkbh5 G T 11: 60,538,703 R94L possibly damaging Het
Ampd3 A G 7: 110,807,871 K644R possibly damaging Het
Ankhd1 T A 18: 36,589,408 L328H probably damaging Het
Ankrd55 G T 13: 112,318,502 V45F probably damaging Het
Apol7c C A 15: 77,526,147 V200F probably damaging Het
Arap1 G A 7: 101,409,130 V721M probably damaging Het
Arhgef40 A G 14: 51,989,699 D400G probably damaging Het
Bmp4 G T 14: 46,384,493 T198K possibly damaging Het
Cblb T A 16: 52,204,653 F970L probably damaging Het
Celf5 A G 10: 81,467,264 S148P probably damaging Het
Ckap5 T A 2: 91,615,141 C1708S possibly damaging Het
Clec2l T C 6: 38,677,524 F147L possibly damaging Het
Cnksr1 T A 4: 134,230,214 I465F possibly damaging Het
Coq10b A G 1: 55,052,984 D37G probably benign Het
Depdc1a G A 3: 159,523,954 probably null Het
Eif2ak4 T A 2: 118,436,158 probably null Het
Eif3e C T 15: 43,252,304 M355I probably damaging Het
Eif4e1b G A 13: 54,786,944 V181M probably damaging Het
Erap1 A G 13: 74,646,561 E113G probably damaging Het
Fads2 A G 19: 10,064,285 L438P probably damaging Het
Fbl T A 7: 28,175,050 V67E probably damaging Het
Gde1 A G 7: 118,705,406 L82P probably damaging Het
Gm10226 T C 17: 21,691,977 S40P possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm1988 T A 7: 39,173,780 noncoding transcript Het
Gm6728 T C 6: 136,486,504 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Jag1 T A 2: 137,085,094 Q915L possibly damaging Het
Kdm5d G A Y: 941,645 G1282D probably benign Het
Krt83 A T 15: 101,486,994 L407Q probably damaging Het
Mlf1 A T 3: 67,393,963 H118L probably damaging Het
Mmp10 G T 9: 7,505,602 C289F probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myo9a T A 9: 59,900,449 S2029T probably damaging Het
Nap1l4 A C 7: 143,534,298 S174R probably damaging Het
Nos3 A G 5: 24,371,944 T490A probably benign Het
Olfr1000 A T 2: 85,608,374 C179S probably damaging Het
Olfr102 T A 17: 37,314,256 I43F probably damaging Het
Olfr1277 T A 2: 111,269,890 Q159L possibly damaging Het
Olfr1459 G A 19: 13,146,501 L53F probably damaging Het
Olfr76 A G 19: 12,120,436 V80A possibly damaging Het
Pdlim7 G C 13: 55,506,162 T214S probably benign Het
Piezo2 T C 18: 63,064,731 E1578G probably damaging Het
Ptcd1 T A 5: 145,147,905 probably benign Het
Sart3 C T 5: 113,759,216 probably null Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn2 A G 11: 97,033,127 D279G possibly damaging Het
Sh2d3c A G 2: 32,745,902 D94G probably damaging Het
Slc12a4 A T 8: 105,951,634 V309E probably damaging Het
Slc1a6 A G 10: 78,787,803 E12G probably damaging Het
Smarcal1 T C 1: 72,595,976 probably null Het
Smr3a T C 5: 88,008,038 probably benign Het
Stox2 A G 8: 47,203,225 I72T probably damaging Het
Tmem234 G T 4: 129,600,707 probably benign Het
Tmem35b A G 4: 127,124,473 Q20R possibly damaging Het
Tom1l2 G A 11: 60,241,808 H430Y probably benign Het
Tpo T C 12: 30,103,290 Y355C probably damaging Het
Tulp2 A G 7: 45,516,651 N122S possibly damaging Het
Washc2 T A 6: 116,259,150 L1194H probably damaging Het
Xbp1 T C 11: 5,521,910 V12A probably benign Het
Other mutations in Cpq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Cpq APN 15 33497287 missense probably benign
IGL01773:Cpq APN 15 33212850 missense probably benign 0.42
IGL02406:Cpq APN 15 33302508 missense probably damaging 1.00
IGL02527:Cpq APN 15 33302363 missense probably damaging 1.00
IGL02596:Cpq APN 15 33213014 missense probably damaging 1.00
IGL02642:Cpq APN 15 33381400 missense probably damaging 0.99
IGL03382:Cpq APN 15 33212943 missense probably damaging 0.96
R0309:Cpq UTSW 15 33594151 missense probably damaging 1.00
R1545:Cpq UTSW 15 33250000 missense probably damaging 1.00
R1698:Cpq UTSW 15 33250126 missense probably benign 0.45
R1967:Cpq UTSW 15 33497202 missense possibly damaging 0.65
R2321:Cpq UTSW 15 33594145 missense probably benign
R2431:Cpq UTSW 15 33594119 nonsense probably null
R4705:Cpq UTSW 15 33497338 missense probably benign
R5087:Cpq UTSW 15 33212862 missense probably benign 0.08
R5790:Cpq UTSW 15 33249997 missense probably damaging 1.00
R6347:Cpq UTSW 15 33290186 intron probably null
R7319:Cpq UTSW 15 33250039 missense probably benign 0.02
X0063:Cpq UTSW 15 33213252 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAATGAGGTCCCTTTTCTTC -3'
(R):5'- AAAACGCAGTACCTCCTGGG -3'

Sequencing Primer
(F):5'- CAAGAATGGTGTTTCTCAGCGAAC -3'
(R):5'- GGGAGTCCCAATGCTGCTG -3'
Posted On2016-09-06