Incidental Mutation 'R5368:Olfr1215'
ID429458
Institutional Source Beutler Lab
Gene Symbol Olfr1215
Ensembl Gene ENSMUSG00000100016
Gene Nameolfactory receptor 1215
SynonymsGA_x6K02T2Q125-50482823-50481885, MOR233-13
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89000021-89006973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89002091 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 66 (S66P)
Ref Sequence ENSEMBL: ENSMUSP00000150030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188399] [ENSMUST00000214809] [ENSMUST00000216271]
Predicted Effect probably damaging
Transcript: ENSMUST00000188399
AA Change: S66P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141134
Gene: ENSMUSG00000100016
AA Change: S66P

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 286 1.9e-25 PFAM
Pfam:7tm_4 138 283 1.7e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214809
AA Change: S66P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216271
AA Change: S66P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Olfr1215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr1215 APN 2 89001339 utr 3 prime probably benign
IGL02395:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02399:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02409:Olfr1215 APN 2 89001910 missense possibly damaging 0.75
IGL02421:Olfr1215 APN 2 89001344 unclassified probably null
IGL03036:Olfr1215 APN 2 89002115 missense possibly damaging 0.94
R2036:Olfr1215 UTSW 2 89001632 missense probably damaging 0.97
R2199:Olfr1215 UTSW 2 89001550 missense probably damaging 0.98
R3930:Olfr1215 UTSW 2 89002033 missense probably benign 0.32
R4990:Olfr1215 UTSW 2 89001472 missense probably damaging 0.97
R5199:Olfr1215 UTSW 2 89001763 missense possibly damaging 0.70
R5396:Olfr1215 UTSW 2 89002196 missense probably benign 0.15
R6881:Olfr1215 UTSW 2 89001937 missense probably damaging 1.00
R7195:Olfr1215 UTSW 2 89001731 missense
Z1088:Olfr1215 UTSW 2 89001838 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACAGAGCCTCCTGTTCATAATTG -3'
(R):5'- CCAAACCATTGTAACTGAGTTCG -3'

Sequencing Primer
(F):5'- GGCTTACAAATGGCTACATACCGG -3'
(R):5'- GTACTCCTGGGACTTTCACAAAAC -3'
Posted On2016-09-06