Incidental Mutation 'R5368:Leng8'
ID429477
Institutional Source Beutler Lab
Gene Symbol Leng8
Ensembl Gene ENSMUSG00000035545
Gene Nameleukocyte receptor cluster (LRC) member 8
Synonyms
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5368 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4137039-4148177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4139988 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 88 (Y88C)
Ref Sequence ENSEMBL: ENSMUSP00000118832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032594] [ENSMUST00000037472] [ENSMUST00000079415] [ENSMUST00000117274] [ENSMUST00000119661] [ENSMUST00000121270] [ENSMUST00000128756] [ENSMUST00000129423] [ENSMUST00000132086] [ENSMUST00000144248] [ENSMUST00000154571]
Predicted Effect probably benign
Transcript: ENSMUST00000032594
SMART Domains Protein: ENSMUSP00000032594
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 1 72 4.7e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037472
AA Change: Y88C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046465
Gene: ENSMUSG00000035545
AA Change: Y88C

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 762 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079415
SMART Domains Protein: ENSMUSP00000078384
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 26 428 3.2e-165 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117274
AA Change: Y88C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113223
Gene: ENSMUSG00000035545
AA Change: Y88C

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119661
SMART Domains Protein: ENSMUSP00000113937
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121270
AA Change: Y88C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112428
Gene: ENSMUSG00000035545
AA Change: Y88C

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 764 7.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127723
Predicted Effect probably damaging
Transcript: ENSMUST00000128756
AA Change: Y88C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118832
Gene: ENSMUSG00000035545
AA Change: Y88C

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129423
SMART Domains Protein: ENSMUSP00000120182
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132086
AA Change: Y70C
SMART Domains Protein: ENSMUSP00000121129
Gene: ENSMUSG00000035545
AA Change: Y70C

DomainStartEndE-ValueType
low complexity region 29 51 N/A INTRINSIC
low complexity region 63 71 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134536
Predicted Effect unknown
Transcript: ENSMUST00000144248
AA Change: Y88C
SMART Domains Protein: ENSMUSP00000120574
Gene: ENSMUSG00000035545
AA Change: Y88C

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 346 359 N/A INTRINSIC
low complexity region 376 410 N/A INTRINSIC
low complexity region 416 431 N/A INTRINSIC
Pfam:SAC3_GANP 530 725 1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148318
Predicted Effect unknown
Transcript: ENSMUST00000154571
AA Change: Y88C
SMART Domains Protein: ENSMUSP00000123328
Gene: ENSMUSG00000035545
AA Change: Y88C

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155881
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Qk T G 17: 10,239,035 E135A probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Leng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Leng8 APN 7 4145482 missense probably benign 0.03
IGL02437:Leng8 APN 7 4142093 missense probably damaging 0.99
R0104:Leng8 UTSW 7 4143808 missense probably damaging 0.99
R0774:Leng8 UTSW 7 4142136 missense probably damaging 1.00
R1696:Leng8 UTSW 7 4145136 missense probably damaging 1.00
R2001:Leng8 UTSW 7 4145074 missense probably damaging 1.00
R2012:Leng8 UTSW 7 4143610 missense probably damaging 1.00
R2054:Leng8 UTSW 7 4144290 nonsense probably null
R3433:Leng8 UTSW 7 4142132 missense probably benign 0.22
R4335:Leng8 UTSW 7 4147038 missense probably damaging 0.99
R4607:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4608:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4886:Leng8 UTSW 7 4144931 unclassified probably null
R5307:Leng8 UTSW 7 4145473 missense probably damaging 1.00
R5339:Leng8 UTSW 7 4145286 missense possibly damaging 0.96
R5370:Leng8 UTSW 7 4145434 missense possibly damaging 0.48
R5615:Leng8 UTSW 7 4144958 nonsense probably null
R5645:Leng8 UTSW 7 4145274 missense probably damaging 1.00
R5750:Leng8 UTSW 7 4142120 missense probably benign 0.04
R6041:Leng8 UTSW 7 4145569 missense probably benign 0.01
R6054:Leng8 UTSW 7 4145523 unclassified probably null
R6481:Leng8 UTSW 7 4145413 missense probably damaging 1.00
R6826:Leng8 UTSW 7 4145320 missense probably damaging 1.00
R6919:Leng8 UTSW 7 4143626 missense possibly damaging 0.82
R7313:Leng8 UTSW 7 4139526 missense possibly damaging 0.73
R7357:Leng8 UTSW 7 4144933 nonsense probably null
R7428:Leng8 UTSW 7 4143573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTACTGTACAGAGTCTGCACC -3'
(R):5'- AGGCAGTGGAAATGTCAGCATC -3'

Sequencing Primer
(F):5'- GTACAGAGTCTGCACCCTTCTG -3'
(R):5'- GGATATGCCAGATCTTATGAGACC -3'
Posted On2016-09-06