Incidental Mutation 'R5370:Leng8'
ID429602
Institutional Source Beutler Lab
Gene Symbol Leng8
Ensembl Gene ENSMUSG00000035545
Gene Nameleukocyte receptor cluster (LRC) member 8
Synonyms
MMRRC Submission 042947-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5370 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4137039-4148177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4145434 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 735 (D735G)
Ref Sequence ENSEMBL: ENSMUSP00000112428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037472] [ENSMUST00000058358] [ENSMUST00000117274] [ENSMUST00000121270] [ENSMUST00000128756] [ENSMUST00000144248] [ENSMUST00000154571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037472
AA Change: D735G

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046465
Gene: ENSMUSG00000035545
AA Change: D735G

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 762 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058358
SMART Domains Protein: ENSMUSP00000061079
Gene: ENSMUSG00000043432

DomainStartEndE-ValueType
ZnF_C3H1 8 34 1.72e-4 SMART
Pfam:DUF504 77 128 1.9e-11 PFAM
Pfam:AKAP7_NLS 305 484 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117274
SMART Domains Protein: ENSMUSP00000113223
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121270
AA Change: D735G

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112428
Gene: ENSMUSG00000035545
AA Change: D735G

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 764 7.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127723
Predicted Effect probably benign
Transcript: ENSMUST00000128756
SMART Domains Protein: ENSMUSP00000118832
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144248
SMART Domains Protein: ENSMUSP00000120574
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 346 359 N/A INTRINSIC
low complexity region 376 410 N/A INTRINSIC
low complexity region 416 431 N/A INTRINSIC
Pfam:SAC3_GANP 530 725 1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146434
Predicted Effect probably benign
Transcript: ENSMUST00000154571
SMART Domains Protein: ENSMUSP00000123328
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155881
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Armc3 A C 2: 19,286,062 T451P probably benign Het
Ass1 G A 2: 31,518,733 V379M possibly damaging Het
Cdhr2 A G 13: 54,720,887 Y554C probably damaging Het
Clec4g C A 8: 3,718,344 R129L probably benign Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dnah9 T A 11: 66,029,354 T2238S probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Ephb2 T C 4: 136,771,570 E66G probably benign Het
Fam169a T A 13: 97,106,962 C167S probably damaging Het
Ggcx T C 6: 72,425,931 S291P possibly damaging Het
Gsdme T A 6: 50,229,306 I186F probably damaging Het
Gzma T A 13: 113,095,795 M191L probably damaging Het
Heatr1 T A 13: 12,401,522 S226T probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs6st1 T A 1: 36,069,081 S142T probably damaging Het
Ighv3-5 A G 12: 114,262,898 V36A probably benign Het
Mapk13 T A 17: 28,776,352 Y182* probably null Het
Mrgprb8 A T 7: 48,388,820 T80S probably benign Het
Myom2 G A 8: 15,099,343 A605T probably benign Het
Nxf1 A G 19: 8,772,140 T134A probably damaging Het
Olfr136 G T 17: 38,335,444 G96* probably null Het
Padi3 C A 4: 140,810,538 E24* probably null Het
Pcdhga3 T A 18: 37,675,290 D265E probably damaging Het
Pros1 A T 16: 62,913,976 I382L probably benign Het
Ptpn23 A G 9: 110,385,701 V1544A possibly damaging Het
Rhoh G T 5: 65,892,578 A64S probably benign Het
Rnf115 A G 3: 96,758,020 T69A probably benign Het
Taf5 A G 19: 47,075,764 E382G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r104 A T 17: 20,030,188 I607N probably damaging Het
Vmn2r11 T C 5: 109,047,555 Y635C probably damaging Het
Vwa5a A G 9: 38,741,216 D765G probably benign Het
Wnk2 T C 13: 49,102,961 D228G probably damaging Het
Xirp2 A G 2: 67,512,152 D1579G possibly damaging Het
Other mutations in Leng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Leng8 APN 7 4145482 missense probably benign 0.03
IGL02437:Leng8 APN 7 4142093 missense probably damaging 0.99
R0104:Leng8 UTSW 7 4143808 missense probably damaging 0.99
R0774:Leng8 UTSW 7 4142136 missense probably damaging 1.00
R1696:Leng8 UTSW 7 4145136 missense probably damaging 1.00
R2001:Leng8 UTSW 7 4145074 missense probably damaging 1.00
R2012:Leng8 UTSW 7 4143610 missense probably damaging 1.00
R2054:Leng8 UTSW 7 4144290 nonsense probably null
R3433:Leng8 UTSW 7 4142132 missense probably benign 0.22
R4335:Leng8 UTSW 7 4147038 missense probably damaging 0.99
R4607:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4608:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4886:Leng8 UTSW 7 4144931 unclassified probably null
R5307:Leng8 UTSW 7 4145473 missense probably damaging 1.00
R5339:Leng8 UTSW 7 4145286 missense possibly damaging 0.96
R5368:Leng8 UTSW 7 4139988 missense probably damaging 0.97
R5615:Leng8 UTSW 7 4144958 nonsense probably null
R5645:Leng8 UTSW 7 4145274 missense probably damaging 1.00
R5750:Leng8 UTSW 7 4142120 missense probably benign 0.04
R6041:Leng8 UTSW 7 4145569 missense probably benign 0.01
R6054:Leng8 UTSW 7 4145523 unclassified probably null
R6481:Leng8 UTSW 7 4145413 missense probably damaging 1.00
R6826:Leng8 UTSW 7 4145320 missense probably damaging 1.00
R6919:Leng8 UTSW 7 4143626 missense possibly damaging 0.82
R7313:Leng8 UTSW 7 4139526 missense possibly damaging 0.73
R7357:Leng8 UTSW 7 4144933 nonsense probably null
R7428:Leng8 UTSW 7 4143573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACATCACTACGGAACTG -3'
(R):5'- ACATGATGCCAGGAGTGGTG -3'

Sequencing Primer
(F):5'- CTACGGAACTGGCATACCTC -3'
(R):5'- AACTGCAGGTGGCCGATG -3'
Posted On2016-09-06