Incidental Mutation 'R5370:Taf5'
ID 429622
Institutional Source Beutler Lab
Gene Symbol Taf5
Ensembl Gene ENSMUSG00000025049
Gene Name TATA-box binding protein associated factor 5
Synonyms 6330528C20Rik
MMRRC Submission 042947-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R5370 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 47056187-47071918 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47064203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 382 (E382G)
Ref Sequence ENSEMBL: ENSMUSP00000026027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026027]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026027
AA Change: E382G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026027
Gene: ENSMUSG00000025049
AA Change: E382G

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 29 92 N/A INTRINSIC
LisH 93 125 6.52e-2 SMART
low complexity region 132 150 N/A INTRINSIC
Pfam:TFIID_NTD2 206 338 4.5e-55 PFAM
low complexity region 389 417 N/A INTRINSIC
WD40 460 499 8.36e-2 SMART
WD40 533 572 1.82e-11 SMART
WD40 575 614 1.19e-6 SMART
WD40 617 656 9.08e-12 SMART
WD40 659 698 1.4e-12 SMART
WD40 701 740 2.57e-11 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes an integral subunit of TFIID associated with all transcriptionally competent forms of that complex. This subunit interacts strongly with two TFIID subunits that show similarity to histones H3 and H4, and it may participate in forming a nucleosome-like core in the TFIID complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,605,137 (GRCm39) R108C possibly damaging Het
Armc3 A C 2: 19,290,873 (GRCm39) T451P probably benign Het
Ass1 G A 2: 31,408,745 (GRCm39) V379M possibly damaging Het
Cdhr2 A G 13: 54,868,700 (GRCm39) Y554C probably damaging Het
Clec4g C A 8: 3,768,344 (GRCm39) R129L probably benign Het
Dip2b C T 15: 100,109,867 (GRCm39) R1451C probably damaging Het
Dnah9 T A 11: 65,920,180 (GRCm39) T2238S probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,563,270 (GRCm39) probably benign Het
Ephb2 T C 4: 136,498,881 (GRCm39) E66G probably benign Het
Fam169a T A 13: 97,243,470 (GRCm39) C167S probably damaging Het
Ggcx T C 6: 72,402,914 (GRCm39) S291P possibly damaging Het
Gsdme T A 6: 50,206,286 (GRCm39) I186F probably damaging Het
Gzma T A 13: 113,232,329 (GRCm39) M191L probably damaging Het
Heatr1 T A 13: 12,416,403 (GRCm39) S226T probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs6st1 T A 1: 36,108,162 (GRCm39) S142T probably damaging Het
Ighv3-5 A G 12: 114,226,518 (GRCm39) V36A probably benign Het
Leng8 A G 7: 4,148,433 (GRCm39) D735G possibly damaging Het
Mapk13 T A 17: 28,995,326 (GRCm39) Y182* probably null Het
Mrgprb8 A T 7: 48,038,568 (GRCm39) T80S probably benign Het
Myom2 G A 8: 15,149,343 (GRCm39) A605T probably benign Het
Nxf1 A G 19: 8,749,504 (GRCm39) T134A probably damaging Het
Or2n1d G T 17: 38,646,335 (GRCm39) G96* probably null Het
Padi3 C A 4: 140,537,849 (GRCm39) E24* probably null Het
Pcdhga3 T A 18: 37,808,343 (GRCm39) D265E probably damaging Het
Pros1 A T 16: 62,734,339 (GRCm39) I382L probably benign Het
Ptpn23 A G 9: 110,214,769 (GRCm39) V1544A possibly damaging Het
Rhoh G T 5: 66,049,921 (GRCm39) A64S probably benign Het
Rnf115 A G 3: 96,665,336 (GRCm39) T69A probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vmn2r104 A T 17: 20,250,450 (GRCm39) I607N probably damaging Het
Vmn2r11 T C 5: 109,195,421 (GRCm39) Y635C probably damaging Het
Vwa5a A G 9: 38,652,512 (GRCm39) D765G probably benign Het
Wnk2 T C 13: 49,256,437 (GRCm39) D228G probably damaging Het
Xirp2 A G 2: 67,342,496 (GRCm39) D1579G possibly damaging Het
Other mutations in Taf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Taf5 APN 19 47,070,740 (GRCm39) missense probably damaging 1.00
IGL01115:Taf5 APN 19 47,063,521 (GRCm39) missense probably benign 0.01
IGL02168:Taf5 APN 19 47,070,917 (GRCm39) missense probably damaging 0.98
IGL02638:Taf5 APN 19 47,056,649 (GRCm39) missense probably benign 0.00
IGL02689:Taf5 APN 19 47,065,704 (GRCm39) splice site probably benign
R0008:Taf5 UTSW 19 47,064,301 (GRCm39) missense possibly damaging 0.94
R0008:Taf5 UTSW 19 47,064,301 (GRCm39) missense possibly damaging 0.94
R0220:Taf5 UTSW 19 47,068,999 (GRCm39) missense probably damaging 1.00
R0685:Taf5 UTSW 19 47,063,293 (GRCm39) missense probably benign 0.10
R1518:Taf5 UTSW 19 47,070,285 (GRCm39) missense probably damaging 1.00
R2329:Taf5 UTSW 19 47,063,563 (GRCm39) missense probably benign 0.07
R3431:Taf5 UTSW 19 47,064,272 (GRCm39) missense probably damaging 1.00
R3432:Taf5 UTSW 19 47,064,272 (GRCm39) missense probably damaging 1.00
R3689:Taf5 UTSW 19 47,067,224 (GRCm39) missense probably damaging 0.99
R4411:Taf5 UTSW 19 47,059,453 (GRCm39) missense probably damaging 1.00
R4413:Taf5 UTSW 19 47,059,453 (GRCm39) missense probably damaging 1.00
R4676:Taf5 UTSW 19 47,063,409 (GRCm39) missense probably damaging 1.00
R5875:Taf5 UTSW 19 47,064,549 (GRCm39) missense probably damaging 1.00
R5883:Taf5 UTSW 19 47,056,228 (GRCm39) missense unknown
R5937:Taf5 UTSW 19 47,070,334 (GRCm39) missense probably damaging 1.00
R6835:Taf5 UTSW 19 47,065,776 (GRCm39) missense possibly damaging 0.94
R7007:Taf5 UTSW 19 47,059,650 (GRCm39) missense probably damaging 1.00
R8198:Taf5 UTSW 19 47,064,212 (GRCm39) missense probably damaging 0.97
R9151:Taf5 UTSW 19 47,063,370 (GRCm39) missense probably damaging 0.98
R9500:Taf5 UTSW 19 47,065,771 (GRCm39) missense probably damaging 1.00
R9762:Taf5 UTSW 19 47,059,434 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACAACAAAAGGCGTGCTG -3'
(R):5'- TCCAACCCTCTGTGACATAGC -3'

Sequencing Primer
(F):5'- CGTGCTGAGTCTCTAAAACCAGG -3'
(R):5'- GACATAGCTTCCACCTTTATGTACG -3'
Posted On 2016-09-06