Incidental Mutation 'R5370:Taf5'
ID429622
Institutional Source Beutler Lab
Gene Symbol Taf5
Ensembl Gene ENSMUSG00000025049
Gene NameTATA-box binding protein associated factor 5
Synonyms6330528C20Rik
MMRRC Submission 042947-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5370 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47067748-47083479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47075764 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 382 (E382G)
Ref Sequence ENSEMBL: ENSMUSP00000026027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026027]
Predicted Effect probably damaging
Transcript: ENSMUST00000026027
AA Change: E382G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026027
Gene: ENSMUSG00000025049
AA Change: E382G

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 29 92 N/A INTRINSIC
LisH 93 125 6.52e-2 SMART
low complexity region 132 150 N/A INTRINSIC
Pfam:TFIID_NTD2 206 338 4.5e-55 PFAM
low complexity region 389 417 N/A INTRINSIC
WD40 460 499 8.36e-2 SMART
WD40 533 572 1.82e-11 SMART
WD40 575 614 1.19e-6 SMART
WD40 617 656 9.08e-12 SMART
WD40 659 698 1.4e-12 SMART
WD40 701 740 2.57e-11 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes an integral subunit of TFIID associated with all transcriptionally competent forms of that complex. This subunit interacts strongly with two TFIID subunits that show similarity to histones H3 and H4, and it may participate in forming a nucleosome-like core in the TFIID complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Armc3 A C 2: 19,286,062 T451P probably benign Het
Ass1 G A 2: 31,518,733 V379M possibly damaging Het
Cdhr2 A G 13: 54,720,887 Y554C probably damaging Het
Clec4g C A 8: 3,718,344 R129L probably benign Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dnah9 T A 11: 66,029,354 T2238S probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Ephb2 T C 4: 136,771,570 E66G probably benign Het
Fam169a T A 13: 97,106,962 C167S probably damaging Het
Ggcx T C 6: 72,425,931 S291P possibly damaging Het
Gsdme T A 6: 50,229,306 I186F probably damaging Het
Gzma T A 13: 113,095,795 M191L probably damaging Het
Heatr1 T A 13: 12,401,522 S226T probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs6st1 T A 1: 36,069,081 S142T probably damaging Het
Ighv3-5 A G 12: 114,262,898 V36A probably benign Het
Leng8 A G 7: 4,145,434 D735G possibly damaging Het
Mapk13 T A 17: 28,776,352 Y182* probably null Het
Mrgprb8 A T 7: 48,388,820 T80S probably benign Het
Myom2 G A 8: 15,099,343 A605T probably benign Het
Nxf1 A G 19: 8,772,140 T134A probably damaging Het
Olfr136 G T 17: 38,335,444 G96* probably null Het
Padi3 C A 4: 140,810,538 E24* probably null Het
Pcdhga3 T A 18: 37,675,290 D265E probably damaging Het
Pros1 A T 16: 62,913,976 I382L probably benign Het
Ptpn23 A G 9: 110,385,701 V1544A possibly damaging Het
Rhoh G T 5: 65,892,578 A64S probably benign Het
Rnf115 A G 3: 96,758,020 T69A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r104 A T 17: 20,030,188 I607N probably damaging Het
Vmn2r11 T C 5: 109,047,555 Y635C probably damaging Het
Vwa5a A G 9: 38,741,216 D765G probably benign Het
Wnk2 T C 13: 49,102,961 D228G probably damaging Het
Xirp2 A G 2: 67,512,152 D1579G possibly damaging Het
Other mutations in Taf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Taf5 APN 19 47082301 missense probably damaging 1.00
IGL01115:Taf5 APN 19 47075082 missense probably benign 0.01
IGL02168:Taf5 APN 19 47082478 missense probably damaging 0.98
IGL02638:Taf5 APN 19 47068210 missense probably benign 0.00
IGL02689:Taf5 APN 19 47077265 splice site probably benign
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0220:Taf5 UTSW 19 47080560 missense probably damaging 1.00
R0685:Taf5 UTSW 19 47074854 missense probably benign 0.10
R1518:Taf5 UTSW 19 47081846 missense probably damaging 1.00
R2329:Taf5 UTSW 19 47075124 missense probably benign 0.07
R3431:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3432:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3689:Taf5 UTSW 19 47078785 missense probably damaging 0.99
R4411:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4413:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4676:Taf5 UTSW 19 47074970 missense probably damaging 1.00
R5875:Taf5 UTSW 19 47076110 missense probably damaging 1.00
R5883:Taf5 UTSW 19 47067789 missense unknown
R5937:Taf5 UTSW 19 47081895 missense probably damaging 1.00
R6835:Taf5 UTSW 19 47077337 missense possibly damaging 0.94
R7007:Taf5 UTSW 19 47071211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAACAAAAGGCGTGCTG -3'
(R):5'- TCCAACCCTCTGTGACATAGC -3'

Sequencing Primer
(F):5'- CGTGCTGAGTCTCTAAAACCAGG -3'
(R):5'- GACATAGCTTCCACCTTTATGTACG -3'
Posted On2016-09-06