Incidental Mutation 'R5396:Myo3b'
ID429627
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission 044394-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5396 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70126985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 185 (I185L)
Ref Sequence ENSEMBL: ENSMUSP00000107860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112241] [ENSMUST00000112243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060208
AA Change: I264L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: I264L

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112241
AA Change: I185L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107860
Gene: ENSMUSG00000042064
AA Change: I185L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 187 3.7e-30 PFAM
Pfam:Pkinase 1 188 8.3e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112243
AA Change: I236L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: I236L

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T C 2: 127,186,953 T109A probably damaging Het
4430402I18Rik T C 19: 28,927,689 H325R possibly damaging Het
9530053A07Rik T C 7: 28,140,183 F474L probably benign Het
A430005L14Rik GCC G 4: 153,960,953 probably null Het
Actr1a T C 19: 46,395,664 D5G possibly damaging Het
Adra2c A G 5: 35,280,873 T330A probably benign Het
Ahcyl2 C T 6: 29,859,698 probably benign Het
Ahnak T C 19: 9,007,175 V1941A probably damaging Het
Akr1b7 G A 6: 34,412,476 probably null Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ank2 A G 3: 126,953,226 V570A probably damaging Het
Ano4 T C 10: 89,112,840 E302G probably damaging Het
Bop1 A T 15: 76,455,289 H285Q probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Catsperb A T 12: 101,594,284 I845L possibly damaging Het
Ccdc28b G T 4: 129,619,445 Q184K probably damaging Het
Cd101 A G 3: 101,018,810 S198P probably damaging Het
Cdc7 A T 5: 106,969,297 probably null Het
Cdhr2 A G 13: 54,736,456 D1268G probably benign Het
Celsr3 C T 9: 108,828,582 R755W probably damaging Het
Chrnb1 T A 11: 69,794,153 N117I probably damaging Het
Chst11 C A 10: 83,191,249 P170Q probably damaging Het
Clca3b A G 3: 144,847,171 Y98H probably damaging Het
Crnkl1 A G 2: 145,928,212 V237A possibly damaging Het
Ctnnbl1 G A 2: 157,817,832 probably null Het
Dbndd1 C A 8: 123,509,843 R95S probably damaging Het
Ddx3y A G Y: 1,265,965 V344A probably damaging Het
Defb30 A T 14: 63,036,110 probably null Het
Dnah17 C T 11: 118,127,282 R129Q probably benign Het
Dnhd1 A T 7: 105,713,684 M3818L probably benign Het
Dusp4 G T 8: 34,817,304 D258Y probably damaging Het
E2f1 A T 2: 154,564,448 F103I probably benign Het
Elavl2 T C 4: 91,260,818 Y248C probably damaging Het
Ephb3 T C 16: 21,219,105 V310A possibly damaging Het
Erbin A G 13: 103,857,409 probably null Het
Etv4 A T 11: 101,775,341 H120Q probably damaging Het
Fam45a T C 19: 60,834,836 L303P probably benign Het
Flot2 T A 11: 78,049,488 C20* probably null Het
Fsip2 G A 2: 82,990,918 G5665D probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Glrp1 TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG 1: 88,503,344 probably benign Het
Gm43302 A T 5: 105,280,089 L202* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hnf1b A T 11: 83,856,037 M160L probably damaging Het
Inhbe T C 10: 127,350,601 T237A possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kmt2c A T 5: 25,294,734 probably null Het
Kyat3 A G 3: 142,734,606 K364E probably benign Het
Lars T A 18: 42,216,959 T927S probably benign Het
Mfap1b A T 2: 121,473,890 M8K probably benign Het
Mroh8 G A 2: 157,228,656 P592S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1215 A T 2: 89,002,196 L31M probably benign Het
Olfr1375 C T 11: 51,048,470 A121V probably damaging Het
Olfr645 T C 7: 104,084,891 Y63C probably benign Het
Pcdha8 T A 18: 36,993,734 V423E probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pde8a T C 7: 81,333,422 V791A probably damaging Het
Pds5a A G 5: 65,638,577 S657P probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Rad51d A G 11: 82,890,370 V17A possibly damaging Het
Sdc1 A T 12: 8,791,743 probably null Het
Sdcbp2 T A 2: 151,587,137 I152N probably damaging Het
Slc4a4 G T 5: 89,046,217 M141I probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spata6 T C 4: 111,799,118 C320R probably damaging Het
Ssu2 T A 6: 112,380,996 T129S probably damaging Het
Stat5a T A 11: 100,880,583 W631R probably damaging Het
Sult1c2 T A 17: 53,836,911 N122I possibly damaging Het
Synpo2 G A 3: 123,117,682 Q105* probably null Het
Tert G A 13: 73,639,243 V783I probably damaging Het
Ticam1 G T 17: 56,271,117 T326K probably benign Het
Tmem63b T C 17: 45,669,962 M269V possibly damaging Het
Tmem86a T A 7: 47,053,046 V73E possibly damaging Het
Trpv4 G A 5: 114,623,614 R818C possibly damaging Het
Tstd2 A G 4: 46,135,542 S4P probably benign Het
Ttn A T 2: 76,814,371 V4686E probably damaging Het
Ubash3b A G 9: 41,043,473 probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Usp33 A G 3: 152,384,187 E780G possibly damaging Het
Vapb T A 2: 173,771,543 Y78* probably null Het
Vps13b G A 15: 35,886,948 R3227Q probably damaging Het
Vps33a A T 5: 123,558,630 I320N probably damaging Het
Wnt5a T C 14: 28,522,770 C305R probably damaging Het
Zbtb38 A G 9: 96,687,643 C463R probably damaging Het
Zc3h12d G A 10: 7,866,326 C263Y probably damaging Het
Zfp971 G A 2: 178,033,733 R375Q probably damaging Het
Znrf1 T A 8: 111,619,194 probably null Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGGTTTCCAGGCATCTG -3'
(R):5'- CTCGCCATTTCTCAGGGAAC -3'

Sequencing Primer
(F):5'- CAGGCATCTGGGGTGACAGTG -3'
(R):5'- TCTCAGGGAACTTATCTTGTAGC -3'
Posted On2016-09-06