Incidental Mutation 'R5396:9530053A07Rik'
ID429665
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission 044394-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5396 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28140183 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 474 (F474L)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect probably benign
Transcript: ENSMUST00000059886
AA Change: F474L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: F474L

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130693
Predicted Effect probably benign
Transcript: ENSMUST00000150948
AA Change: F474L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: F474L

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T C 2: 127,186,953 T109A probably damaging Het
4430402I18Rik T C 19: 28,927,689 H325R possibly damaging Het
A430005L14Rik GCC G 4: 153,960,953 probably null Het
Actr1a T C 19: 46,395,664 D5G possibly damaging Het
Adra2c A G 5: 35,280,873 T330A probably benign Het
Ahcyl2 C T 6: 29,859,698 probably benign Het
Ahnak T C 19: 9,007,175 V1941A probably damaging Het
Akr1b7 G A 6: 34,412,476 probably null Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ank2 A G 3: 126,953,226 V570A probably damaging Het
Ano4 T C 10: 89,112,840 E302G probably damaging Het
Bop1 A T 15: 76,455,289 H285Q probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Catsperb A T 12: 101,594,284 I845L possibly damaging Het
Ccdc28b G T 4: 129,619,445 Q184K probably damaging Het
Cd101 A G 3: 101,018,810 S198P probably damaging Het
Cdc7 A T 5: 106,969,297 probably null Het
Cdhr2 A G 13: 54,736,456 D1268G probably benign Het
Celsr3 C T 9: 108,828,582 R755W probably damaging Het
Chrnb1 T A 11: 69,794,153 N117I probably damaging Het
Chst11 C A 10: 83,191,249 P170Q probably damaging Het
Clca3b A G 3: 144,847,171 Y98H probably damaging Het
Crnkl1 A G 2: 145,928,212 V237A possibly damaging Het
Ctnnbl1 G A 2: 157,817,832 probably null Het
Dbndd1 C A 8: 123,509,843 R95S probably damaging Het
Ddx3y A G Y: 1,265,965 V344A probably damaging Het
Defb30 A T 14: 63,036,110 probably null Het
Dnah17 C T 11: 118,127,282 R129Q probably benign Het
Dnhd1 A T 7: 105,713,684 M3818L probably benign Het
Dusp4 G T 8: 34,817,304 D258Y probably damaging Het
E2f1 A T 2: 154,564,448 F103I probably benign Het
Elavl2 T C 4: 91,260,818 Y248C probably damaging Het
Ephb3 T C 16: 21,219,105 V310A possibly damaging Het
Erbin A G 13: 103,857,409 probably null Het
Etv4 A T 11: 101,775,341 H120Q probably damaging Het
Fam45a T C 19: 60,834,836 L303P probably benign Het
Flot2 T A 11: 78,049,488 C20* probably null Het
Fsip2 G A 2: 82,990,918 G5665D probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Glrp1 TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG 1: 88,503,344 probably benign Het
Gm43302 A T 5: 105,280,089 L202* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hnf1b A T 11: 83,856,037 M160L probably damaging Het
Inhbe T C 10: 127,350,601 T237A possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kmt2c A T 5: 25,294,734 probably null Het
Kyat3 A G 3: 142,734,606 K364E probably benign Het
Lars T A 18: 42,216,959 T927S probably benign Het
Mfap1b A T 2: 121,473,890 M8K probably benign Het
Mroh8 G A 2: 157,228,656 P592S possibly damaging Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1215 A T 2: 89,002,196 L31M probably benign Het
Olfr1375 C T 11: 51,048,470 A121V probably damaging Het
Olfr645 T C 7: 104,084,891 Y63C probably benign Het
Pcdha8 T A 18: 36,993,734 V423E probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pde8a T C 7: 81,333,422 V791A probably damaging Het
Pds5a A G 5: 65,638,577 S657P probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Rad51d A G 11: 82,890,370 V17A possibly damaging Het
Sdc1 A T 12: 8,791,743 probably null Het
Sdcbp2 T A 2: 151,587,137 I152N probably damaging Het
Slc4a4 G T 5: 89,046,217 M141I probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spata6 T C 4: 111,799,118 C320R probably damaging Het
Ssu2 T A 6: 112,380,996 T129S probably damaging Het
Stat5a T A 11: 100,880,583 W631R probably damaging Het
Sult1c2 T A 17: 53,836,911 N122I possibly damaging Het
Synpo2 G A 3: 123,117,682 Q105* probably null Het
Tert G A 13: 73,639,243 V783I probably damaging Het
Ticam1 G T 17: 56,271,117 T326K probably benign Het
Tmem63b T C 17: 45,669,962 M269V possibly damaging Het
Tmem86a T A 7: 47,053,046 V73E possibly damaging Het
Trpv4 G A 5: 114,623,614 R818C possibly damaging Het
Tstd2 A G 4: 46,135,542 S4P probably benign Het
Ttn A T 2: 76,814,371 V4686E probably damaging Het
Ubash3b A G 9: 41,043,473 probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Usp33 A G 3: 152,384,187 E780G possibly damaging Het
Vapb T A 2: 173,771,543 Y78* probably null Het
Vps13b G A 15: 35,886,948 R3227Q probably damaging Het
Vps33a A T 5: 123,558,630 I320N probably damaging Het
Wnt5a T C 14: 28,522,770 C305R probably damaging Het
Zbtb38 A G 9: 96,687,643 C463R probably damaging Het
Zc3h12d G A 10: 7,866,326 C263Y probably damaging Het
Zfp971 G A 2: 178,033,733 R375Q probably damaging Het
Znrf1 T A 8: 111,619,194 probably null Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATGGAGCCACTCAGAAGGTG -3'
(R):5'- GAATGAATCCCACTCTGCTTCC -3'

Sequencing Primer
(F):5'- CCACTCAGAAGGTGATCTGTAG -3'
(R):5'- TCCTAAGGCCTCCAACTT -3'
Posted On2016-09-06