Incidental Mutation 'R5396:Rad51d'
ID429692
Institutional Source Beutler Lab
Gene Symbol Rad51d
Ensembl Gene ENSMUSG00000018841
Gene NameRAD51 paralog D
SynonymsR51H3, Rad51d
MMRRC Submission 044394-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5396 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82876434-82890614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82890370 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000117401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018985] [ENSMUST00000018988] [ENSMUST00000021033] [ENSMUST00000092844] [ENSMUST00000100718] [ENSMUST00000135963] [ENSMUST00000146053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018985
AA Change: V17A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018985
Gene: ENSMUSG00000018841
AA Change: V17A

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 2e-27 PDB
AAA 99 274 1.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000018988
SMART Domains Protein: ENSMUSP00000018988
Gene: ENSMUSG00000018844

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
FN3 176 264 9.48e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000021033
AA Change: V17A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021033
Gene: ENSMUSG00000018841
AA Change: V17A

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 249 3e-15 PFAM
Pfam:AAA_25 69 200 2e-12 PFAM
Pfam:KaiC 82 148 1.4e-10 PFAM
Pfam:AAA_19 93 168 6.7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092844
AA Change: V17A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090520
Gene: ENSMUSG00000018841
AA Change: V17A

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 66 130 2.4e-7 PFAM
Pfam:KaiC 82 129 8e-8 PFAM
Pfam:Rad51 115 274 8.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100718
AA Change: V17A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098284
Gene: ENSMUSG00000018841
AA Change: V17A

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 5e-30 PDB
SCOP:d1b22a_ 10 48 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135963
AA Change: V17A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122477
Gene: ENSMUSG00000018841
AA Change: V17A

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 219 7e-18 PFAM
Pfam:AAA_25 69 226 2.6e-15 PFAM
Pfam:KaiC 82 216 5.7e-12 PFAM
Pfam:AAA_19 93 168 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146053
AA Change: V17A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117401
Gene: ENSMUSG00000018841
AA Change: V17A

DomainStartEndE-ValueType
PDB:2KZ3|A 1 48 1e-13 PDB
SCOP:d1b22a_ 10 48 7e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the Rad51 gene family whose products play a major role in homologous recombination and DNA repair. The encoded protein interacts with other proteins of this family, including Rad51b, Rad51c and Xrcc2, and plays an essential role in both DNA repair and telomere maintenance. In humans, germline mutations in this gene may be associated with predisposition to ovarian cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T C 2: 127,186,953 T109A probably damaging Het
4430402I18Rik T C 19: 28,927,689 H325R possibly damaging Het
9530053A07Rik T C 7: 28,140,183 F474L probably benign Het
A430005L14Rik GCC G 4: 153,960,953 probably null Het
Actr1a T C 19: 46,395,664 D5G possibly damaging Het
Adra2c A G 5: 35,280,873 T330A probably benign Het
Ahcyl2 C T 6: 29,859,698 probably benign Het
Ahnak T C 19: 9,007,175 V1941A probably damaging Het
Akr1b7 G A 6: 34,412,476 probably null Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ank2 A G 3: 126,953,226 V570A probably damaging Het
Ano4 T C 10: 89,112,840 E302G probably damaging Het
Bop1 A T 15: 76,455,289 H285Q probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Catsperb A T 12: 101,594,284 I845L possibly damaging Het
Ccdc28b G T 4: 129,619,445 Q184K probably damaging Het
Cd101 A G 3: 101,018,810 S198P probably damaging Het
Cdc7 A T 5: 106,969,297 probably null Het
Cdhr2 A G 13: 54,736,456 D1268G probably benign Het
Celsr3 C T 9: 108,828,582 R755W probably damaging Het
Chrnb1 T A 11: 69,794,153 N117I probably damaging Het
Chst11 C A 10: 83,191,249 P170Q probably damaging Het
Clca3b A G 3: 144,847,171 Y98H probably damaging Het
Crnkl1 A G 2: 145,928,212 V237A possibly damaging Het
Ctnnbl1 G A 2: 157,817,832 probably null Het
Dbndd1 C A 8: 123,509,843 R95S probably damaging Het
Ddx3y A G Y: 1,265,965 V344A probably damaging Het
Defb30 A T 14: 63,036,110 probably null Het
Dnah17 C T 11: 118,127,282 R129Q probably benign Het
Dnhd1 A T 7: 105,713,684 M3818L probably benign Het
Dusp4 G T 8: 34,817,304 D258Y probably damaging Het
E2f1 A T 2: 154,564,448 F103I probably benign Het
Elavl2 T C 4: 91,260,818 Y248C probably damaging Het
Ephb3 T C 16: 21,219,105 V310A possibly damaging Het
Erbin A G 13: 103,857,409 probably null Het
Etv4 A T 11: 101,775,341 H120Q probably damaging Het
Fam45a T C 19: 60,834,836 L303P probably benign Het
Flot2 T A 11: 78,049,488 C20* probably null Het
Fsip2 G A 2: 82,990,918 G5665D probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Glrp1 TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG 1: 88,503,344 probably benign Het
Gm43302 A T 5: 105,280,089 L202* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hnf1b A T 11: 83,856,037 M160L probably damaging Het
Inhbe T C 10: 127,350,601 T237A possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kmt2c A T 5: 25,294,734 probably null Het
Kyat3 A G 3: 142,734,606 K364E probably benign Het
Lars T A 18: 42,216,959 T927S probably benign Het
Mfap1b A T 2: 121,473,890 M8K probably benign Het
Mroh8 G A 2: 157,228,656 P592S possibly damaging Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1215 A T 2: 89,002,196 L31M probably benign Het
Olfr1375 C T 11: 51,048,470 A121V probably damaging Het
Olfr645 T C 7: 104,084,891 Y63C probably benign Het
Pcdha8 T A 18: 36,993,734 V423E probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pde8a T C 7: 81,333,422 V791A probably damaging Het
Pds5a A G 5: 65,638,577 S657P probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Sdc1 A T 12: 8,791,743 probably null Het
Sdcbp2 T A 2: 151,587,137 I152N probably damaging Het
Slc4a4 G T 5: 89,046,217 M141I probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spata6 T C 4: 111,799,118 C320R probably damaging Het
Ssu2 T A 6: 112,380,996 T129S probably damaging Het
Stat5a T A 11: 100,880,583 W631R probably damaging Het
Sult1c2 T A 17: 53,836,911 N122I possibly damaging Het
Synpo2 G A 3: 123,117,682 Q105* probably null Het
Tert G A 13: 73,639,243 V783I probably damaging Het
Ticam1 G T 17: 56,271,117 T326K probably benign Het
Tmem63b T C 17: 45,669,962 M269V possibly damaging Het
Tmem86a T A 7: 47,053,046 V73E possibly damaging Het
Trpv4 G A 5: 114,623,614 R818C possibly damaging Het
Tstd2 A G 4: 46,135,542 S4P probably benign Het
Ttn A T 2: 76,814,371 V4686E probably damaging Het
Ubash3b A G 9: 41,043,473 probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Usp33 A G 3: 152,384,187 E780G possibly damaging Het
Vapb T A 2: 173,771,543 Y78* probably null Het
Vps13b G A 15: 35,886,948 R3227Q probably damaging Het
Vps33a A T 5: 123,558,630 I320N probably damaging Het
Wnt5a T C 14: 28,522,770 C305R probably damaging Het
Zbtb38 A G 9: 96,687,643 C463R probably damaging Het
Zc3h12d G A 10: 7,866,326 C263Y probably damaging Het
Zfp971 G A 2: 178,033,733 R375Q probably damaging Het
Znrf1 T A 8: 111,619,194 probably null Het
Other mutations in Rad51d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Rad51d APN 11 82889746 missense probably damaging 1.00
IGL02755:Rad51d APN 11 82881632 missense probably benign 0.05
IGL03270:Rad51d APN 11 82881594 splice site probably benign
spew UTSW 11 82879333 missense probably damaging 0.99
R0179:Rad51d UTSW 11 82889998 missense possibly damaging 0.90
R1440:Rad51d UTSW 11 82890353 nonsense probably null
R1771:Rad51d UTSW 11 82883938 missense probably damaging 1.00
R2106:Rad51d UTSW 11 82879308 missense probably damaging 1.00
R2340:Rad51d UTSW 11 82881821 missense probably damaging 1.00
R6917:Rad51d UTSW 11 82879333 missense probably damaging 0.99
R6941:Rad51d UTSW 11 82889797 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAAAATCCTCTGCCTCGGC -3'
(R):5'- CCTAGAGTCTTGCGAGTTGG -3'

Sequencing Primer
(F):5'- CTCCTGCGAACCCAGCTTC -3'
(R):5'- CTAGAGTCTTGCGAGTTGGGAAGG -3'
Posted On2016-09-06