Incidental Mutation 'R5396:Ahnak'
ID429716
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene NameAHNAK nucleoprotein (desmoyokin)
Synonyms1110004P15Rik, 2310047C17Rik, DY6
MMRRC Submission 044394-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R5396 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8989284-9076919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9007175 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1941 (V1941A)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092956
AA Change: V1941A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: V1941A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T C 2: 127,186,953 T109A probably damaging Het
4430402I18Rik T C 19: 28,927,689 H325R possibly damaging Het
9530053A07Rik T C 7: 28,140,183 F474L probably benign Het
A430005L14Rik GCC G 4: 153,960,953 probably null Het
Actr1a T C 19: 46,395,664 D5G possibly damaging Het
Adra2c A G 5: 35,280,873 T330A probably benign Het
Ahcyl2 C T 6: 29,859,698 probably benign Het
Akr1b7 G A 6: 34,412,476 probably null Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ank2 A G 3: 126,953,226 V570A probably damaging Het
Ano4 T C 10: 89,112,840 E302G probably damaging Het
Bop1 A T 15: 76,455,289 H285Q probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Catsperb A T 12: 101,594,284 I845L possibly damaging Het
Ccdc28b G T 4: 129,619,445 Q184K probably damaging Het
Cd101 A G 3: 101,018,810 S198P probably damaging Het
Cdc7 A T 5: 106,969,297 probably null Het
Cdhr2 A G 13: 54,736,456 D1268G probably benign Het
Celsr3 C T 9: 108,828,582 R755W probably damaging Het
Chrnb1 T A 11: 69,794,153 N117I probably damaging Het
Chst11 C A 10: 83,191,249 P170Q probably damaging Het
Clca3b A G 3: 144,847,171 Y98H probably damaging Het
Crnkl1 A G 2: 145,928,212 V237A possibly damaging Het
Ctnnbl1 G A 2: 157,817,832 probably null Het
Dbndd1 C A 8: 123,509,843 R95S probably damaging Het
Ddx3y A G Y: 1,265,965 V344A probably damaging Het
Defb30 A T 14: 63,036,110 probably null Het
Dnah17 C T 11: 118,127,282 R129Q probably benign Het
Dnhd1 A T 7: 105,713,684 M3818L probably benign Het
Dusp4 G T 8: 34,817,304 D258Y probably damaging Het
E2f1 A T 2: 154,564,448 F103I probably benign Het
Elavl2 T C 4: 91,260,818 Y248C probably damaging Het
Ephb3 T C 16: 21,219,105 V310A possibly damaging Het
Erbin A G 13: 103,857,409 probably null Het
Etv4 A T 11: 101,775,341 H120Q probably damaging Het
Fam45a T C 19: 60,834,836 L303P probably benign Het
Flot2 T A 11: 78,049,488 C20* probably null Het
Fsip2 G A 2: 82,990,918 G5665D probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Glrp1 TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG 1: 88,503,344 probably benign Het
Gm43302 A T 5: 105,280,089 L202* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hnf1b A T 11: 83,856,037 M160L probably damaging Het
Inhbe T C 10: 127,350,601 T237A possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kmt2c A T 5: 25,294,734 probably null Het
Kyat3 A G 3: 142,734,606 K364E probably benign Het
Lars T A 18: 42,216,959 T927S probably benign Het
Mfap1b A T 2: 121,473,890 M8K probably benign Het
Mroh8 G A 2: 157,228,656 P592S possibly damaging Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1215 A T 2: 89,002,196 L31M probably benign Het
Olfr1375 C T 11: 51,048,470 A121V probably damaging Het
Olfr645 T C 7: 104,084,891 Y63C probably benign Het
Pcdha8 T A 18: 36,993,734 V423E probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pde8a T C 7: 81,333,422 V791A probably damaging Het
Pds5a A G 5: 65,638,577 S657P probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Rad51d A G 11: 82,890,370 V17A possibly damaging Het
Sdc1 A T 12: 8,791,743 probably null Het
Sdcbp2 T A 2: 151,587,137 I152N probably damaging Het
Slc4a4 G T 5: 89,046,217 M141I probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spata6 T C 4: 111,799,118 C320R probably damaging Het
Ssu2 T A 6: 112,380,996 T129S probably damaging Het
Stat5a T A 11: 100,880,583 W631R probably damaging Het
Sult1c2 T A 17: 53,836,911 N122I possibly damaging Het
Synpo2 G A 3: 123,117,682 Q105* probably null Het
Tert G A 13: 73,639,243 V783I probably damaging Het
Ticam1 G T 17: 56,271,117 T326K probably benign Het
Tmem63b T C 17: 45,669,962 M269V possibly damaging Het
Tmem86a T A 7: 47,053,046 V73E possibly damaging Het
Trpv4 G A 5: 114,623,614 R818C possibly damaging Het
Tstd2 A G 4: 46,135,542 S4P probably benign Het
Ttn A T 2: 76,814,371 V4686E probably damaging Het
Ubash3b A G 9: 41,043,473 probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Usp33 A G 3: 152,384,187 E780G possibly damaging Het
Vapb T A 2: 173,771,543 Y78* probably null Het
Vps13b G A 15: 35,886,948 R3227Q probably damaging Het
Vps33a A T 5: 123,558,630 I320N probably damaging Het
Wnt5a T C 14: 28,522,770 C305R probably damaging Het
Zbtb38 A G 9: 96,687,643 C463R probably damaging Het
Zc3h12d G A 10: 7,866,326 C263Y probably damaging Het
Zfp971 G A 2: 178,033,733 R375Q probably damaging Het
Znrf1 T A 8: 111,619,194 probably null Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 9007223 missense probably damaging 0.99
IGL00509:Ahnak APN 19 9009951 missense possibly damaging 0.94
IGL00539:Ahnak APN 19 9007908 missense possibly damaging 0.50
IGL00558:Ahnak APN 19 9004307 missense possibly damaging 0.93
IGL00567:Ahnak APN 19 9013383 missense probably benign 0.24
IGL00706:Ahnak APN 19 9013730 nonsense probably null
IGL00807:Ahnak APN 19 9008522 missense possibly damaging 0.92
IGL00870:Ahnak APN 19 9013698 missense probably damaging 1.00
IGL01101:Ahnak APN 19 9012887 intron probably benign
IGL01118:Ahnak APN 19 9012578 missense probably damaging 1.00
IGL01288:Ahnak APN 19 9002494 missense possibly damaging 0.94
IGL01324:Ahnak APN 19 9003032 missense probably damaging 1.00
IGL01341:Ahnak APN 19 9011703 missense probably benign
IGL01541:Ahnak APN 19 9007879 missense possibly damaging 0.95
IGL01580:Ahnak APN 19 9002839 missense probably benign 0.02
IGL01595:Ahnak APN 19 9003501 nonsense probably null
IGL01746:Ahnak APN 19 9004912 missense possibly damaging 0.89
IGL01766:Ahnak APN 19 9000118 missense unknown
IGL01821:Ahnak APN 19 9012118 missense probably benign
IGL01913:Ahnak APN 19 9006064 nonsense probably null
IGL01934:Ahnak APN 19 9002657 missense probably damaging 1.00
IGL01940:Ahnak APN 19 9006557 missense probably benign 0.14
IGL01958:Ahnak APN 19 9014909 missense possibly damaging 0.59
IGL02145:Ahnak APN 19 9002855 missense probably benign 0.11
IGL02246:Ahnak APN 19 9008268 missense probably damaging 1.00
IGL02282:Ahnak APN 19 9005987 missense probably damaging 1.00
IGL02428:Ahnak APN 19 9014833 missense possibly damaging 0.83
IGL02442:Ahnak APN 19 9004016 missense probably damaging 1.00
IGL02474:Ahnak APN 19 9004933 missense probably benign 0.13
IGL02483:Ahnak APN 19 9003308 missense probably benign 0.01
IGL02616:Ahnak APN 19 9005627 missense probably benign 0.03
IGL02630:Ahnak APN 19 9012077 missense probably damaging 1.00
IGL02690:Ahnak APN 19 9012584 nonsense probably null
IGL02717:Ahnak APN 19 9002387 missense probably benign 0.00
IGL02721:Ahnak APN 19 9009707 missense probably benign 0.07
IGL02737:Ahnak APN 19 9004593 missense probably benign 0.17
IGL02850:Ahnak APN 19 9002596 missense probably benign 0.00
IGL03071:Ahnak APN 19 9011918 missense possibly damaging 0.63
IGL03072:Ahnak APN 19 9006508 missense probably benign 0.11
IGL03094:Ahnak APN 19 9003547 missense possibly damaging 0.64
IGL03140:Ahnak APN 19 9005212 intron probably benign
IGL03176:Ahnak APN 19 9008166 missense possibly damaging 0.56
IGL03176:Ahnak APN 19 9002449 missense probably damaging 1.00
IGL03189:Ahnak APN 19 9011239 missense possibly damaging 0.65
IGL03357:Ahnak APN 19 9009325 intron probably benign
IGL03371:Ahnak APN 19 9004228 missense possibly damaging 0.91
Eskimo UTSW 19 9009574 missense probably benign 0.31
nanook UTSW 19 9003231 missense probably benign 0.42
netsilik UTSW 19 9002321 missense probably benign 0.00
IGL03097:Ahnak UTSW 19 9002387 missense probably benign 0.00
R0054:Ahnak UTSW 19 9012056 missense probably damaging 1.00
R0094:Ahnak UTSW 19 9013893 missense probably benign 0.12
R0110:Ahnak UTSW 19 9018232 nonsense probably null
R0141:Ahnak UTSW 19 9006680 missense probably damaging 1.00
R0166:Ahnak UTSW 19 9005725 missense probably damaging 1.00
R0309:Ahnak UTSW 19 9002495 missense probably damaging 1.00
R0368:Ahnak UTSW 19 9008350 nonsense probably null
R0386:Ahnak UTSW 19 9011144 missense possibly damaging 0.94
R0401:Ahnak UTSW 19 9015116 missense probably benign 0.24
R0415:Ahnak UTSW 19 9012871 intron probably benign
R0463:Ahnak UTSW 19 9009407 intron probably benign
R0469:Ahnak UTSW 19 9018232 nonsense probably null
R0470:Ahnak UTSW 19 9008967 missense probably benign 0.29
R0487:Ahnak UTSW 19 9007151 missense probably benign 0.00
R0487:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R0499:Ahnak UTSW 19 9000264 splice site probably benign
R0506:Ahnak UTSW 19 9009128 missense probably damaging 1.00
R0510:Ahnak UTSW 19 9018232 nonsense probably null
R0557:Ahnak UTSW 19 9001944 missense probably benign 0.10
R0570:Ahnak UTSW 19 9013698 missense probably damaging 1.00
R0610:Ahnak UTSW 19 9007878 missense probably benign 0.08
R0646:Ahnak UTSW 19 9013402 nonsense probably null
R0659:Ahnak UTSW 19 9015002 missense possibly damaging 0.60
R0791:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0792:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0840:Ahnak UTSW 19 9005063 missense probably damaging 1.00
R0847:Ahnak UTSW 19 9006433 nonsense probably null
R0941:Ahnak UTSW 19 9009914 missense probably damaging 1.00
R0962:Ahnak UTSW 19 9012848 intron probably benign
R1017:Ahnak UTSW 19 9010543 missense probably damaging 0.99
R1037:Ahnak UTSW 19 9007618 missense probably benign 0.27
R1085:Ahnak UTSW 19 9013125 missense possibly damaging 0.50
R1113:Ahnak UTSW 19 9005620 missense probably benign 0.29
R1140:Ahnak UTSW 19 9004245 missense probably damaging 1.00
R1158:Ahnak UTSW 19 9013926 missense probably benign 0.00
R1218:Ahnak UTSW 19 9015619 missense probably damaging 1.00
R1225:Ahnak UTSW 19 9002883 missense probably damaging 1.00
R1245:Ahnak UTSW 19 9004169 missense probably benign 0.44
R1421:Ahnak UTSW 19 9015631 missense possibly damaging 0.95
R1447:Ahnak UTSW 19 9007082 missense probably damaging 0.98
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1471:Ahnak UTSW 19 9012932 intron probably benign
R1507:Ahnak UTSW 19 9010077 missense probably damaging 1.00
R1521:Ahnak UTSW 19 9004728 missense probably benign 0.11
R1568:Ahnak UTSW 19 9002375 missense probably damaging 0.98
R1569:Ahnak UTSW 19 9004094 missense possibly damaging 0.78
R1616:Ahnak UTSW 19 9008987 missense possibly damaging 0.94
R1638:Ahnak UTSW 19 9009449 missense probably benign 0.01
R1680:Ahnak UTSW 19 9009963 missense probably benign 0.05
R1713:Ahnak UTSW 19 9011809 missense possibly damaging 0.95
R1722:Ahnak UTSW 19 9010655 missense probably damaging 0.99
R1771:Ahnak UTSW 19 9013753 missense probably benign 0.24
R1795:Ahnak UTSW 19 9002438 missense possibly damaging 0.79
R1823:Ahnak UTSW 19 9004905 missense probably damaging 0.99
R1842:Ahnak UTSW 19 9005867 missense probably damaging 0.99
R1854:Ahnak UTSW 19 9013832 missense possibly damaging 0.61
R1856:Ahnak UTSW 19 9002048 missense possibly damaging 0.86
R1886:Ahnak UTSW 19 9015979 missense probably damaging 0.98
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1912:Ahnak UTSW 19 9017881 missense probably damaging 1.00
R1913:Ahnak UTSW 19 9007922 missense probably damaging 0.99
R1942:Ahnak UTSW 19 9015083 missense probably damaging 0.98
R1987:Ahnak UTSW 19 9015251 missense probably damaging 1.00
R2006:Ahnak UTSW 19 9007075 missense probably damaging 1.00
R2013:Ahnak UTSW 19 9014573 missense probably damaging 0.98
R2014:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R2047:Ahnak UTSW 19 9014300 missense possibly damaging 0.67
R2048:Ahnak UTSW 19 9007056 missense probably damaging 0.99
R2060:Ahnak UTSW 19 9008041 missense probably benign 0.08
R2083:Ahnak UTSW 19 9011557 missense probably damaging 1.00
R2157:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R2167:Ahnak UTSW 19 9011494 nonsense probably null
R2208:Ahnak UTSW 19 9017732 missense probably benign 0.00
R2224:Ahnak UTSW 19 9012991 intron probably benign
R2268:Ahnak UTSW 19 9010574 missense possibly damaging 0.66
R2420:Ahnak UTSW 19 9009256 missense possibly damaging 0.89
R2426:Ahnak UTSW 19 9002851 missense possibly damaging 0.81
R2910:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2911:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2981:Ahnak UTSW 19 9000148 missense probably damaging 0.97
R3151:Ahnak UTSW 19 9009944 missense probably benign 0.12
R3155:Ahnak UTSW 19 9010177 missense possibly damaging 0.49
R3422:Ahnak UTSW 19 9005708 missense probably benign 0.39
R3422:Ahnak UTSW 19 9006752 missense probably benign 0.05
R3430:Ahnak UTSW 19 9006958 missense probably benign 0.42
R3433:Ahnak UTSW 19 9009994 missense probably benign 0.01
R3711:Ahnak UTSW 19 9007898 missense probably benign
R3723:Ahnak UTSW 19 9016853 missense possibly damaging 0.79
R3775:Ahnak UTSW 19 9009023 missense possibly damaging 0.91
R3858:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3859:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3922:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3924:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3926:Ahnak UTSW 19 9006328 missense probably benign 0.20
R4026:Ahnak UTSW 19 9011299 missense probably damaging 0.97
R4051:Ahnak UTSW 19 9014327 missense probably damaging 1.00
R4209:Ahnak UTSW 19 9002600 missense probably damaging 1.00
R4234:Ahnak UTSW 19 9000786 nonsense probably null
R4237:Ahnak UTSW 19 9001783 missense probably benign 0.02
R4285:Ahnak UTSW 19 9016839 nonsense probably null
R4331:Ahnak UTSW 19 9015820 missense probably damaging 1.00
R4342:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R4430:Ahnak UTSW 19 9003040 missense probably benign 0.00
R4554:Ahnak UTSW 19 9014930 missense probably damaging 1.00
R4602:Ahnak UTSW 19 9010825 missense possibly damaging 0.66
R4612:Ahnak UTSW 19 9003724 missense probably benign 0.44
R4655:Ahnak UTSW 19 9008701 missense probably damaging 1.00
R4656:Ahnak UTSW 19 9004855 missense possibly damaging 0.80
R4700:Ahnak UTSW 19 9004681 missense probably benign 0.02
R4704:Ahnak UTSW 19 9012258 intron probably benign
R4704:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R4705:Ahnak UTSW 19 9016906 missense probably benign 0.07
R4707:Ahnak UTSW 19 9016735 missense probably benign 0.03
R4732:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4733:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4778:Ahnak UTSW 19 9011975 missense possibly damaging 0.79
R4782:Ahnak UTSW 19 9012499 intron probably benign
R4832:Ahnak UTSW 19 9012460 intron probably benign
R4882:Ahnak UTSW 19 9005897 missense probably damaging 0.98
R4884:Ahnak UTSW 19 9012754 intron probably benign
R4895:Ahnak UTSW 19 9017441 missense probably benign 0.43
R4930:Ahnak UTSW 19 9010967 missense possibly damaging 0.79
R4951:Ahnak UTSW 19 9017835 missense probably damaging 1.00
R4968:Ahnak UTSW 19 9015100 missense probably damaging 1.00
R5026:Ahnak UTSW 19 9010631 missense possibly damaging 0.46
R5050:Ahnak UTSW 19 9012458 intron probably benign
R5073:Ahnak UTSW 19 9003231 missense probably benign 0.42
R5110:Ahnak UTSW 19 9014759 missense probably damaging 1.00
R5119:Ahnak UTSW 19 9013644 missense probably benign 0.00
R5128:Ahnak UTSW 19 9017087 missense probably damaging 1.00
R5139:Ahnak UTSW 19 9004655 missense probably damaging 1.00
R5150:Ahnak UTSW 19 9010904 missense possibly damaging 0.46
R5151:Ahnak UTSW 19 9017569 missense probably benign 0.03
R5165:Ahnak UTSW 19 9015665 missense possibly damaging 0.95
R5236:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R5361:Ahnak UTSW 19 9015341 missense possibly damaging 0.92
R5366:Ahnak UTSW 19 9016735 missense possibly damaging 0.65
R5387:Ahnak UTSW 19 9003691 missense probably damaging 1.00
R5583:Ahnak UTSW 19 9006917 missense probably damaging 0.99
R5587:Ahnak UTSW 19 9009476 missense possibly damaging 0.88
R5620:Ahnak UTSW 19 9013094 nonsense probably null
R5643:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5644:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5657:Ahnak UTSW 19 9014615 missense probably damaging 0.99
R5688:Ahnak UTSW 19 9002519 missense probably benign 0.01
R5702:Ahnak UTSW 19 9001840 missense probably damaging 1.00
R5727:Ahnak UTSW 19 9016747 missense probably damaging 0.99
R5730:Ahnak UTSW 19 9010253 missense possibly damaging 0.81
R5755:Ahnak UTSW 19 9001732 missense probably benign 0.06
R5760:Ahnak UTSW 19 9013562 missense probably damaging 1.00
R5789:Ahnak UTSW 19 9002321 missense probably benign 0.00
R5790:Ahnak UTSW 19 9015248 missense probably damaging 0.99
R5795:Ahnak UTSW 19 9012382 nonsense probably null
R5808:Ahnak UTSW 19 9010235 missense possibly damaging 0.91
R5867:Ahnak UTSW 19 9010052 missense probably damaging 0.99
R5878:Ahnak UTSW 19 9008342 missense probably damaging 1.00
R5898:Ahnak UTSW 19 9013767 missense possibly damaging 0.63
R5898:Ahnak UTSW 19 9018211 missense probably damaging 1.00
R5912:Ahnak UTSW 19 9011903 missense probably damaging 0.99
R5935:Ahnak UTSW 19 9015182 missense possibly damaging 0.91
R5969:Ahnak UTSW 19 9016585 missense probably damaging 1.00
R5988:Ahnak UTSW 19 9009347 intron probably benign
R6000:Ahnak UTSW 19 9013111 nonsense probably null
R6005:Ahnak UTSW 19 9015161 missense possibly damaging 0.61
R6101:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6105:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6116:Ahnak UTSW 19 9012963 intron probably benign
R6209:Ahnak UTSW 19 9012566 missense probably damaging 1.00
R6240:Ahnak UTSW 19 9013583 missense probably damaging 1.00
R6255:Ahnak UTSW 19 9008025 missense possibly damaging 0.95
R6263:Ahnak UTSW 19 9018277 missense probably benign 0.03
R6287:Ahnak UTSW 19 9015003 missense probably benign 0.02
R6296:Ahnak UTSW 19 9003305 missense probably damaging 0.99
R6315:Ahnak UTSW 19 9006626 missense probably damaging 0.99
R6328:Ahnak UTSW 19 9007148 missense probably benign 0.11
R6331:Ahnak UTSW 19 9006625 missense probably benign 0.18
R6355:Ahnak UTSW 19 9008762 missense probably benign 0.02
R6409:Ahnak UTSW 19 9009574 missense probably benign 0.31
R6567:Ahnak UTSW 19 9008806 missense probably benign 0.27
R6572:Ahnak UTSW 19 9007976 missense probably damaging 0.99
R6574:Ahnak UTSW 19 9017047 missense probably benign 0.04
R6590:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6620:Ahnak UTSW 19 9015310 missense possibly damaging 0.95
R6690:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6731:Ahnak UTSW 19 9011562 missense possibly damaging 0.85
R6756:Ahnak UTSW 19 9007561 missense possibly damaging 0.59
R6846:Ahnak UTSW 19 9011857 missense possibly damaging 0.66
R6854:Ahnak UTSW 19 9015235 missense probably damaging 1.00
R6857:Ahnak UTSW 19 9037168 nonsense probably null
R6863:Ahnak UTSW 19 9012365 intron probably benign
R6876:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R6958:Ahnak UTSW 19 9015215 missense possibly damaging 0.88
R7126:Ahnak UTSW 19 9002359 missense not run
X0021:Ahnak UTSW 19 9013619 missense probably damaging 0.99
X0027:Ahnak UTSW 19 9012037 missense probably damaging 1.00
Z1088:Ahnak UTSW 19 9016082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTTGAATATCAAGGCCGCC -3'
(R):5'- GCCTTTCAACTTTGCATCAGG -3'

Sequencing Primer
(F):5'- CAAGATCTCTATGCCCGATGTGG -3'
(R):5'- ACTTTGCATCAGGACATTCCAG -3'
Posted On2016-09-06