Incidental Mutation 'R5398:Traf1'
ID429781
Institutional Source Beutler Lab
Gene Symbol Traf1
Ensembl Gene ENSMUSG00000026875
Gene NameTNF receptor-associated factor 1
Synonyms4732496E14Rik
MMRRC Submission 042969-MU
Accession Numbers

Genbank: NM_009421; MGI: 101836

Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34941750-34961772 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34945435 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 325 (E325G)
Ref Sequence ENSEMBL: ENSMUSP00000130759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028234] [ENSMUST00000113064] [ENSMUST00000172159]
Predicted Effect probably damaging
Transcript: ENSMUST00000028234
AA Change: E325G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028234
Gene: ENSMUSG00000026875
AA Change: E325G

DomainStartEndE-ValueType
Pfam:TRAF_BIRC3_bd 175 238 8.4e-19 PFAM
MATH 264 386 8.29e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113064
AA Change: E325G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108687
Gene: ENSMUSG00000026875
AA Change: E325G

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
MATH 264 386 8.29e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129131
Predicted Effect probably damaging
Transcript: ENSMUST00000172159
AA Change: E325G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130759
Gene: ENSMUSG00000026875
AA Change: E325G

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
MATH 264 386 8.29e-20 SMART
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice exhibit abnormal T cell functionality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I61N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Tyw1 T C 5: 130,277,157 probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Traf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Traf1 APN 2 34943893 missense probably benign 0.00
IGL01993:Traf1 APN 2 34946867 splice site probably benign
IGL02429:Traf1 APN 2 34949103 missense probably benign
IGL02752:Traf1 APN 2 34958008 missense probably benign 0.00
IGL02933:Traf1 APN 2 34949095 missense possibly damaging 0.55
IGL03346:Traf1 APN 2 34948472 missense probably benign 0.01
3-1:Traf1 UTSW 2 34949106 critical splice acceptor site probably null
R0220:Traf1 UTSW 2 34949103 missense probably benign
R2064:Traf1 UTSW 2 34948190 missense probably benign 0.07
R4458:Traf1 UTSW 2 34945433 missense probably damaging 1.00
R4797:Traf1 UTSW 2 34956277 missense probably benign 0.17
R6221:Traf1 UTSW 2 34948301 missense probably benign 0.45
R6584:Traf1 UTSW 2 34958058 missense probably damaging 1.00
R6792:Traf1 UTSW 2 34956275 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGGATTTGCATTCGGCTTC -3'
(R):5'- CACTTTCCTAGAGAAGAGGGC -3'

Sequencing Primer
(F):5'- GCATTCGGCTTCATTTTATAGAAGG -3'
(R):5'- CCCCGATATCCTCAGGGTTC -3'
Posted On2016-09-06