Incidental Mutation 'R5398:Chac1'
ID429784
Institutional Source Beutler Lab
Gene Symbol Chac1
Ensembl Gene ENSMUSG00000027313
Gene NameChaC, cation transport regulator 1
SynonymsBotch, 1810008K03Rik
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119351229-119354381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119353244 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 109 (L109R)
Ref Sequence ENSEMBL: ENSMUSP00000028780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028780
AA Change: L109R

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028780
Gene: ENSMUSG00000027313
AA Change: L109R

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:ChaC 34 209 2.2e-71 PFAM
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I61N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Chac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Chac1 APN 2 119353559 missense probably benign
IGL02611:Chac1 APN 2 119353453 missense probably damaging 1.00
R0218:Chac1 UTSW 2 119353460 nonsense probably null
R0862:Chac1 UTSW 2 119353469 missense probably damaging 0.96
R0864:Chac1 UTSW 2 119353469 missense probably damaging 0.96
R1734:Chac1 UTSW 2 119353458 missense probably damaging 1.00
R5609:Chac1 UTSW 2 119351406 missense unknown
R5641:Chac1 UTSW 2 119351518 missense probably damaging 1.00
R6416:Chac1 UTSW 2 119353534 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCCAGTCAAACACGTTAG -3'
(R):5'- TGTGGCAATGACCTCTTCAG -3'

Sequencing Primer
(F):5'- CTCCAAAGGGCCTGGATTTGATAC -3'
(R):5'- CAATGACCTCTTCAGGAGCAGG -3'
Posted On2016-09-06