Incidental Mutation 'R5398:Sppl2a'
ID429785
Institutional Source Beutler Lab
Gene Symbol Sppl2a
Ensembl Gene ENSMUSG00000027366
Gene Namesignal peptide peptidase like 2A
SynonymsC130089K23Rik, 2010106G01Rik
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126890391-126933235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126919718 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 289 (I289V)
Ref Sequence ENSEMBL: ENSMUSP00000028844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028844]
Predicted Effect probably benign
Transcript: ENSMUST00000028844
AA Change: I289V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028844
Gene: ENSMUSG00000027366
AA Change: I289V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:PA 58 153 1.7e-12 PFAM
transmembrane domain 173 195 N/A INTRINSIC
PSN 218 486 3.65e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125592
Predicted Effect unknown
Transcript: ENSMUST00000143700
AA Change: I17V
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases, which are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions, as well as a member of the signal peptide peptidase-like protease (SPPL) family. This protein is expressed in all major adult human tissues and localizes to late endosomal compartments and lysosomal membranes. A pseudogene of this gene also lies on chromosome 15. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased immunoglobulin prior to and after immunization and decreased splenic B cells, myeloid dendritic cells, T2 B cells and follicular B cells. Mice homozygous for a hypomorphic allele exhibit similar albeit less severe phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably benign Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I345N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 S374P probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Sppl2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Sppl2a APN 2 126919720 missense probably benign 0.04
IGL01471:Sppl2a APN 2 126917867 nonsense probably null
IGL01572:Sppl2a APN 2 126920312 unclassified probably benign
IGL01712:Sppl2a APN 2 126904903 unclassified probably benign
IGL02203:Sppl2a APN 2 126904941 missense possibly damaging 0.68
IGL02572:Sppl2a APN 2 126926296 missense probably benign 0.07
abra UTSW 2 126923594 missense probably benign 0.00
abra2 UTSW 2 126920313 splice donor site probably null
R0023:Sppl2a UTSW 2 126913293 splice site probably benign
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0458:Sppl2a UTSW 2 126904959 missense probably damaging 1.00
R0627:Sppl2a UTSW 2 126920417 splice site probably benign
R0799:Sppl2a UTSW 2 126920307 splice site probably benign
R1029:Sppl2a UTSW 2 126923594 missense probably benign 0.00
R1245:Sppl2a UTSW 2 126913521 splice site probably benign
R1669:Sppl2a UTSW 2 126917794 splice site probably benign
R2047:Sppl2a UTSW 2 126926852 missense probably damaging 1.00
R2215:Sppl2a UTSW 2 126927834 missense probably benign 0.00
R2428:Sppl2a UTSW 2 126912695 missense possibly damaging 0.93
R3522:Sppl2a UTSW 2 126920322 missense possibly damaging 0.66
R4653:Sppl2a UTSW 2 126920313 splice site probably benign
R6382:Sppl2a UTSW 2 126917029 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTAGCAACGGGGCTCATACAG -3'
(R):5'- GTTGAGGCAGTTATTATGCCTC -3'

Sequencing Primer
(F):5'- gctcatacagagatcctgtT -3'
(R):5'- AGGCAGTTATTATGCCTCATTGG -3'
Posted OnSep 06, 2016