Incidental Mutation 'R5398:Tchhl1'
ID429790
Institutional Source Beutler Lab
Gene Symbol Tchhl1
Ensembl Gene ENSMUSG00000027908
Gene Nametrichohyalin-like 1
SynonymsThhl1, S100a17
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.018) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93468754-93471980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93471603 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 538 (I538T)
Ref Sequence ENSEMBL: ENSMUSP00000029516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029516]
Predicted Effect probably benign
Transcript: ENSMUST00000029516
AA Change: I538T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000029516
Gene: ENSMUSG00000027908
AA Change: I538T

DomainStartEndE-ValueType
Pfam:S_100 4 47 1.2e-15 PFAM
low complexity region 111 124 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I345N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 S374P probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Tchhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tchhl1 APN 3 93470923 missense probably benign 0.00
IGL00803:Tchhl1 APN 3 93470900 missense probably benign 0.00
IGL01075:Tchhl1 APN 3 93470316 missense probably damaging 1.00
IGL01814:Tchhl1 APN 3 93470349 missense possibly damaging 0.53
IGL02026:Tchhl1 APN 3 93470555 missense probably damaging 0.99
IGL02407:Tchhl1 APN 3 93471327 missense possibly damaging 0.95
IGL03286:Tchhl1 APN 3 93471123 missense probably benign 0.00
IGL03293:Tchhl1 APN 3 93470275 missense probably damaging 1.00
Reef UTSW 3 93471029 nonsense probably null
R0371:Tchhl1 UTSW 3 93469577 missense probably damaging 1.00
R0403:Tchhl1 UTSW 3 93471029 nonsense probably null
R0763:Tchhl1 UTSW 3 93471571 missense probably benign 0.05
R1052:Tchhl1 UTSW 3 93470213 missense probably benign 0.32
R1848:Tchhl1 UTSW 3 93471101 missense probably damaging 1.00
R4917:Tchhl1 UTSW 3 93470316 missense possibly damaging 0.52
R4918:Tchhl1 UTSW 3 93470316 missense possibly damaging 0.52
R4945:Tchhl1 UTSW 3 93471576 missense probably benign 0.00
R5251:Tchhl1 UTSW 3 93470553 missense possibly damaging 0.70
R5260:Tchhl1 UTSW 3 93470795 missense probably damaging 1.00
R5759:Tchhl1 UTSW 3 93471556 missense probably damaging 1.00
R5760:Tchhl1 UTSW 3 93471556 missense probably damaging 1.00
R5872:Tchhl1 UTSW 3 93470529 missense probably benign 0.31
R6591:Tchhl1 UTSW 3 93470809 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCACTTGAGAAGCAATC -3'
(R):5'- GAGCTCAGACCATCATGCAG -3'

Sequencing Primer
(F):5'- ACAGGGCCACCAGGATTCAG -3'
(R):5'- ATCATGCAGACCATCTCTGG -3'
Posted On2016-09-06