Incidental Mutation 'R5398:Kif24'
ID429792
Institutional Source Beutler Lab
Gene Symbol Kif24
Ensembl Gene ENSMUSG00000028438
Gene Namekinesin family member 24
Synonyms4933425J19Rik
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41390745-41464887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41394401 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 824 (E824G)
Ref Sequence ENSEMBL: ENSMUSP00000030148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030148] [ENSMUST00000072866] [ENSMUST00000108055] [ENSMUST00000108060]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030148
AA Change: E824G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030148
Gene: ENSMUSG00000028438
AA Change: E824G

DomainStartEndE-ValueType
KISc 216 413 2.51e-29 SMART
low complexity region 481 499 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 626 644 N/A INTRINSIC
low complexity region 678 695 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072866
SMART Domains Protein: ENSMUSP00000072643
Gene: ENSMUSG00000028437

DomainStartEndE-ValueType
coiled coil region 64 95 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
SCOP:d1ifya_ 387 430 5e-10 SMART
PDB:4AE4|B 388 502 1e-74 PDB
Blast:UBA 392 428 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108055
AA Change: E958G

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103690
Gene: ENSMUSG00000028438
AA Change: E958G

DomainStartEndE-ValueType
Blast:KISc 82 205 1e-47 BLAST
KISc 216 547 3.09e-134 SMART
low complexity region 615 633 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 812 829 N/A INTRINSIC
low complexity region 1253 1264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108060
SMART Domains Protein: ENSMUSP00000103695
Gene: ENSMUSG00000028437

DomainStartEndE-ValueType
coiled coil region 64 95 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
PDB:4AE4|B 362 441 2e-50 PDB
SCOP:d1exja1 394 437 1e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141951
Meta Mutation Damage Score 0.0472 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I61N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Kif24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif24 APN 4 41413826 splice site probably null
IGL00787:Kif24 APN 4 41397583 missense probably damaging 1.00
IGL01065:Kif24 APN 4 41423639 unclassified probably benign
IGL01716:Kif24 APN 4 41393454 missense probably benign 0.40
IGL01796:Kif24 APN 4 41392978 unclassified probably benign
IGL02307:Kif24 APN 4 41395274 missense probably benign 0.02
IGL03061:Kif24 APN 4 41394323 missense possibly damaging 0.86
IGL03080:Kif24 APN 4 41394417 missense probably benign 0.12
IGL03100:Kif24 APN 4 41394446 missense possibly damaging 0.59
R0226:Kif24 UTSW 4 41414939 nonsense probably null
R0345:Kif24 UTSW 4 41428413 missense probably benign 0.01
R0365:Kif24 UTSW 4 41428731 missense probably benign 0.06
R0366:Kif24 UTSW 4 41428717 missense possibly damaging 0.77
R0579:Kif24 UTSW 4 41393706 missense probably damaging 0.97
R0682:Kif24 UTSW 4 41428620 missense probably benign 0.01
R1611:Kif24 UTSW 4 41423552 missense probably benign 0.02
R1634:Kif24 UTSW 4 41393529 missense probably benign 0.02
R1772:Kif24 UTSW 4 41409787 missense probably damaging 1.00
R1997:Kif24 UTSW 4 41392904 missense possibly damaging 0.92
R3833:Kif24 UTSW 4 41395064 missense probably damaging 1.00
R3849:Kif24 UTSW 4 41404734 missense probably damaging 1.00
R4356:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4357:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4358:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4359:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4406:Kif24 UTSW 4 41393954 missense probably damaging 1.00
R4580:Kif24 UTSW 4 41395287 missense probably damaging 1.00
R4756:Kif24 UTSW 4 41397545 critical splice donor site probably null
R4921:Kif24 UTSW 4 41394329 missense probably damaging 0.99
R4935:Kif24 UTSW 4 41394939 missense probably damaging 0.99
R5288:Kif24 UTSW 4 41395373 missense probably benign 0.09
R5885:Kif24 UTSW 4 41423463 missense probably damaging 1.00
R5901:Kif24 UTSW 4 41428604 missense probably damaging 1.00
R5919:Kif24 UTSW 4 41394477 missense possibly damaging 0.62
R5945:Kif24 UTSW 4 41428670 nonsense probably null
R6278:Kif24 UTSW 4 41423498 missense probably damaging 1.00
R6291:Kif24 UTSW 4 41413959 missense probably damaging 1.00
R6891:Kif24 UTSW 4 41394168 missense probably benign 0.33
Z1088:Kif24 UTSW 4 41395091 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCCAGAGTCCTCTTGGAAAG -3'
(R):5'- GAGGAGCACTCAGTCAAAGC -3'

Sequencing Primer
(F):5'- AAAGGAGTGCTGCTGTTCAC -3'
(R):5'- GCCACAGCCCAAGTATGGTATG -3'
Posted On2016-09-06