Incidental Mutation 'R5398:Btbd19'
ID429793
Institutional Source Beutler Lab
Gene Symbol Btbd19
Ensembl Gene ENSMUSG00000073771
Gene NameBTB (POZ) domain containing 19
Synonyms9530048O09Rik
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R5398 (G1)
Quality Score194
Status Validated
Chromosome4
Chromosomal Location117119219-117125725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117123760 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 104 (A104V)
Ref Sequence ENSEMBL: ENSMUSP00000138230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062206] [ENSMUST00000076859] [ENSMUST00000134074] [ENSMUST00000143213] [ENSMUST00000144269] [ENSMUST00000153257] [ENSMUST00000183310]
Predicted Effect probably benign
Transcript: ENSMUST00000062206
SMART Domains Protein: ENSMUSP00000052243
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 121 217 3.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076859
SMART Domains Protein: ENSMUSP00000076130
Gene: ENSMUSG00000028680

DomainStartEndE-ValueType
low complexity region 9 36 N/A INTRINSIC
S_TKc 63 315 2.15e-96 SMART
Pfam:POLO_box 473 534 2.7e-16 PFAM
low complexity region 554 566 N/A INTRINSIC
Pfam:POLO_box 570 638 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097915
SMART Domains Protein: ENSMUSP00000095528
Gene: ENSMUSG00000073771

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126135
Predicted Effect probably benign
Transcript: ENSMUST00000134074
SMART Domains Protein: ENSMUSP00000114182
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143213
Predicted Effect probably benign
Transcript: ENSMUST00000144269
SMART Domains Protein: ENSMUSP00000122605
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 118 178 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147730
SMART Domains Protein: ENSMUSP00000120476
Gene: ENSMUSG00000028680

DomainStartEndE-ValueType
low complexity region 1 9 N/A INTRINSIC
S_TKc 42 294 2.15e-96 SMART
Pfam:POLO_box 435 496 5.3e-17 PFAM
low complexity region 516 528 N/A INTRINSIC
Pfam:POLO_box 532 600 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153257
SMART Domains Protein: ENSMUSP00000121768
Gene: ENSMUSG00000073771

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:BACK 33 84 5e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181979
Predicted Effect probably damaging
Transcript: ENSMUST00000183310
AA Change: A104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138230
Gene: ENSMUSG00000073771
AA Change: A104V

DomainStartEndE-ValueType
BTB 29 124 1.82e-18 SMART
BACK 129 233 4.17e-8 SMART
low complexity region 260 280 N/A INTRINSIC
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I61N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Btbd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3690:Btbd19 UTSW 4 117120592 utr 3 prime probably benign
R3691:Btbd19 UTSW 4 117120592 utr 3 prime probably benign
R4907:Btbd19 UTSW 4 117120567 utr 3 prime probably benign
R5052:Btbd19 UTSW 4 117122257 missense possibly damaging 0.60
R5163:Btbd19 UTSW 4 117121431 missense probably damaging 1.00
R5396:Btbd19 UTSW 4 117123760 missense probably damaging 1.00
R5399:Btbd19 UTSW 4 117123760 missense probably damaging 1.00
R5998:Btbd19 UTSW 4 117120999 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ATTCACCGTTGCACTGAAGAAC -3'
(R):5'- CCAACACTCTGTGAGCCTAC -3'

Sequencing Primer
(F):5'- CAGCCATAAATACTTCCTGTGC -3'
(R):5'- TCTGTGAGCCTACCAAGCAGAG -3'
Posted On2016-09-06