Incidental Mutation 'R5398:Ociad1'
ID429794
Institutional Source Beutler Lab
Gene Symbol Ociad1
Ensembl Gene ENSMUSG00000029152
Gene NameOCIA domain containing 1
SynonymsB230209J16Rik, Emi2, TPA018, 6030432N09Rik, Imi2, expressed during mesenchymal induction 2, Asrij
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73292784-73314069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73310412 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 231 (V231E)
Ref Sequence ENSEMBL: ENSMUSP00000031038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031038] [ENSMUST00000071081] [ENSMUST00000166823] [ENSMUST00000200935] [ENSMUST00000201556] [ENSMUST00000201739] [ENSMUST00000202237] [ENSMUST00000202250]
Predicted Effect probably benign
Transcript: ENSMUST00000031038
AA Change: V231E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031038
Gene: ENSMUSG00000029152
AA Change: V231E

DomainStartEndE-ValueType
Pfam:OCIA 8 112 8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071081
SMART Domains Protein: ENSMUSP00000069412
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 3 112 8.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166823
SMART Domains Protein: ENSMUSP00000128805
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 3 112 8.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200935
SMART Domains Protein: ENSMUSP00000144515
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 4.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201272
Predicted Effect probably benign
Transcript: ENSMUST00000201556
SMART Domains Protein: ENSMUSP00000144227
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201739
Predicted Effect probably benign
Transcript: ENSMUST00000202237
AA Change: V177E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144102
Gene: ENSMUSG00000029152
AA Change: V177E

DomainStartEndE-ValueType
Pfam:OCIA 1 58 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202250
SMART Domains Protein: ENSMUSP00000143799
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 4.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202887
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I61N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Ociad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ociad1 APN 5 73304543 splice site probably benign
IGL00801:Ociad1 APN 5 73304566 missense probably damaging 1.00
IGL02402:Ociad1 APN 5 73300694 missense possibly damaging 0.72
IGL03197:Ociad1 APN 5 73294332 missense probably benign 0.00
Bequerel UTSW 5 73310382 missense probably benign 0.01
Curie UTSW 5 73310345 nonsense probably null
R0420:Ociad1 UTSW 5 73313429 splice site probably null
R0707:Ociad1 UTSW 5 73294912 splice site probably benign
R1130:Ociad1 UTSW 5 73294332 missense probably benign 0.00
R1744:Ociad1 UTSW 5 73300719 critical splice donor site probably null
R2848:Ociad1 UTSW 5 73294351 splice site probably null
R3157:Ociad1 UTSW 5 73310345 nonsense probably null
R3159:Ociad1 UTSW 5 73310345 nonsense probably null
R4686:Ociad1 UTSW 5 73306735 missense possibly damaging 0.77
R5002:Ociad1 UTSW 5 73310316 missense possibly damaging 0.82
R5483:Ociad1 UTSW 5 73294971 missense probably damaging 1.00
R5921:Ociad1 UTSW 5 73310382 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGCCTCTAGTATCTTGGAATGGTAG -3'
(R):5'- TCAAATGTTGTGTGTTGCATCA -3'

Sequencing Primer
(F):5'- ATCTTGGAATGGTAGCAATAGTTTG -3'
(R):5'- CTAAACGCAGGTCATCAGGCTTG -3'
Posted On2016-09-06