Incidental Mutation 'R5398:Wdr11'
ID429798
Institutional Source Beutler Lab
Gene Symbol Wdr11
Ensembl Gene ENSMUSG00000042055
Gene NameWD repeat domain 11
SynonymsBrwd2, Wdr11
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location129591863-129635738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129631232 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 996 (T996M)
Ref Sequence ENSEMBL: ENSMUSP00000081567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084519]
Predicted Effect probably damaging
Transcript: ENSMUST00000084519
AA Change: T996M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081567
Gene: ENSMUSG00000042055
AA Change: T996M

DomainStartEndE-ValueType
WD40 50 99 2e-1 SMART
WD40 102 145 2.84e2 SMART
low complexity region 189 200 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 454 465 N/A INTRINSIC
WD40 552 595 4.42e1 SMART
WD40 696 735 1.66e0 SMART
WD40 737 777 1.43e1 SMART
WD40 780 821 1.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140877
Predicted Effect probably benign
Transcript: ENSMUST00000148752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149541
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is located in the chromosome 10q25-26 region, which is frequently deleted in gliomas and tumors of other tissues, and is disrupted by the t(10;19) translocation rearrangement in glioblastoma cells. The gene location suggests that it is a candidate gene for the tumor suppressor locus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I345N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 S374P probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Other mutations in Wdr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Wdr11 APN 7 129593093 splice site probably null
IGL01121:Wdr11 APN 7 129628022 missense probably benign 0.02
IGL01385:Wdr11 APN 7 129607913 missense probably benign
IGL01923:Wdr11 APN 7 129632322 critical splice acceptor site probably null
IGL02274:Wdr11 APN 7 129631172 critical splice acceptor site probably null
IGL02894:Wdr11 APN 7 129631166 unclassified probably benign
IGL02927:Wdr11 APN 7 129607098 critical splice donor site probably null
IGL03008:Wdr11 APN 7 129606991 unclassified probably benign
IGL03026:Wdr11 APN 7 129624336 missense probably damaging 1.00
IGL03354:Wdr11 APN 7 129625302 missense probably benign 0.01
IGL03379:Wdr11 APN 7 129599123 missense probably damaging 1.00
R0003:Wdr11 UTSW 7 129599061 missense probably damaging 1.00
R0928:Wdr11 UTSW 7 129606653 missense probably damaging 1.00
R1170:Wdr11 UTSW 7 129607107 splice site probably benign
R1645:Wdr11 UTSW 7 129613889 missense probably benign 0.29
R1908:Wdr11 UTSW 7 129605230 missense possibly damaging 0.60
R1938:Wdr11 UTSW 7 129606607 missense probably benign 0.08
R2122:Wdr11 UTSW 7 129631766 missense probably damaging 1.00
R2148:Wdr11 UTSW 7 129629083 intron probably null
R2240:Wdr11 UTSW 7 129605694 critical splice acceptor site probably null
R2362:Wdr11 UTSW 7 129634836 missense probably benign 0.05
R3774:Wdr11 UTSW 7 129631693 splice site probably null
R4297:Wdr11 UTSW 7 129625186 missense probably benign 0.18
R4546:Wdr11 UTSW 7 129629005 missense probably damaging 1.00
R4787:Wdr11 UTSW 7 129608934 splice site probably benign
R4789:Wdr11 UTSW 7 129618670 nonsense probably null
R4807:Wdr11 UTSW 7 129628022 missense probably benign 0.02
R4855:Wdr11 UTSW 7 129600434 splice site probably null
R4898:Wdr11 UTSW 7 129633721 missense probably benign
R5022:Wdr11 UTSW 7 129624711 missense probably benign 0.10
R5326:Wdr11 UTSW 7 129625249 missense probably damaging 1.00
R6120:Wdr11 UTSW 7 129624791 missense probably damaging 0.99
R6136:Wdr11 UTSW 7 129618703 missense possibly damaging 0.86
R6280:Wdr11 UTSW 7 129599106 nonsense probably null
R6352:Wdr11 UTSW 7 129606675 missense possibly damaging 0.91
R6432:Wdr11 UTSW 7 129606518 missense possibly damaging 0.83
R6766:Wdr11 UTSW 7 129624312 missense probably benign 0.02
R6911:Wdr11 UTSW 7 129607095 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGAAAGACCTGCTTCTCTGC -3'
(R):5'- CAAGCTCTGACACCGTTAAAG -3'

Sequencing Primer
(F):5'- GCTTCTCTGCAAGCTTATAAACAC -3'
(R):5'- CACCGTTAAAGAAAGCCTAAGTGTG -3'
Posted On2016-09-06