Incidental Mutation 'R5398:Ranbp17'
ID429806
Institutional Source Beutler Lab
Gene Symbol Ranbp17
Ensembl Gene ENSMUSG00000040594
Gene NameRAN binding protein 17
Synonyms4932704E15Rik
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location33211795-33513746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33474998 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 453 (Y453N)
Ref Sequence ENSEMBL: ENSMUSP00000137898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037522] [ENSMUST00000102815] [ENSMUST00000129179]
Predicted Effect probably damaging
Transcript: ENSMUST00000037522
AA Change: Y453N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035840
Gene: ENSMUSG00000040594
AA Change: Y453N

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102815
AA Change: Y453N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594
AA Change: Y453N

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129179
AA Change: Y453N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137898
Gene: ENSMUSG00000040594
AA Change: Y453N

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I345N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 S374P probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Ranbp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ranbp17 APN 11 33493402 missense probably benign 0.13
IGL00582:Ranbp17 APN 11 33504683 unclassified probably damaging 0.99
IGL00698:Ranbp17 APN 11 33441910 missense probably benign 0.00
IGL00789:Ranbp17 APN 11 33243249 missense probably benign 0.27
IGL01304:Ranbp17 APN 11 33266147 missense possibly damaging 0.91
IGL01936:Ranbp17 APN 11 33487689 missense probably benign 0.00
IGL01937:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01945:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01993:Ranbp17 APN 11 33500770 unclassified possibly damaging 0.48
IGL02588:Ranbp17 APN 11 33217361 missense probably benign
IGL02870:Ranbp17 APN 11 33243262 missense probably damaging 1.00
IGL03149:Ranbp17 APN 11 33243183 missense possibly damaging 0.76
R0079:Ranbp17 UTSW 11 33500682 missense probably damaging 1.00
R0349:Ranbp17 UTSW 11 33500689 missense probably benign
R0395:Ranbp17 UTSW 11 33474896 missense probably benign
R1456:Ranbp17 UTSW 11 33266310 missense probably damaging 1.00
R1539:Ranbp17 UTSW 11 33297394 missense probably damaging 0.99
R1542:Ranbp17 UTSW 11 33264672 missense probably benign
R1770:Ranbp17 UTSW 11 33217301 missense probably benign 0.31
R2216:Ranbp17 UTSW 11 33481125 missense probably damaging 1.00
R2656:Ranbp17 UTSW 11 33243122 missense probably benign
R2883:Ranbp17 UTSW 11 33504708 missense probably damaging 1.00
R3498:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3499:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3721:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3788:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3790:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3914:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3915:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3949:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4021:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4022:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4027:Ranbp17 UTSW 11 33500718 missense possibly damaging 0.67
R4421:Ranbp17 UTSW 11 33475056 missense probably benign 0.01
R4462:Ranbp17 UTSW 11 33217421 critical splice acceptor site probably null
R4659:Ranbp17 UTSW 11 33266288 missense probably damaging 1.00
R4791:Ranbp17 UTSW 11 33487746 missense probably benign 0.11
R4837:Ranbp17 UTSW 11 33328451 missense probably damaging 1.00
R4914:Ranbp17 UTSW 11 33213425 missense probably benign
R4939:Ranbp17 UTSW 11 33219223 missense probably benign 0.31
R5119:Ranbp17 UTSW 11 33404181 intron probably null
R5171:Ranbp17 UTSW 11 33217419 missense probably benign
R5182:Ranbp17 UTSW 11 33219287 intron probably benign
R5288:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5384:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5385:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R6658:Ranbp17 UTSW 11 33219214 nonsense probably null
R6701:Ranbp17 UTSW 11 33475066 missense probably damaging 1.00
R6796:Ranbp17 UTSW 11 33217398 missense probably benign
R6869:Ranbp17 UTSW 11 33513074 start gained probably benign
X0013:Ranbp17 UTSW 11 33289562 critical splice donor site probably null
X0024:Ranbp17 UTSW 11 33213404 makesense probably null
Predicted Primers PCR Primer
(F):5'- AAGGACTCTGACAATGATTCCC -3'
(R):5'- GAGCAGCAGGTTTGTATTTTGAACTAG -3'

Sequencing Primer
(F):5'- GGACTCTGACAATGATTCCCTATGG -3'
(R):5'- TGTAGACCAGACTGGCCTTGAAC -3'
Posted On2016-09-06