Incidental Mutation 'R5398:Srebf2'
ID429817
Institutional Source Beutler Lab
Gene Symbol Srebf2
Ensembl Gene ENSMUSG00000022463
Gene Namesterol regulatory element binding factor 2
Synonymsnuc, bHLHd2, lop13, SREBP-2, SREBP2gc, SREBP2
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5398 (G1)
Quality Score190
Status Validated
Chromosome15
Chromosomal Location82147181-82205379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82171242 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 176 (T176A)
Ref Sequence ENSEMBL: ENSMUSP00000155022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023100] [ENSMUST00000229009] [ENSMUST00000229336]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023100
AA Change: T216A

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023100
Gene: ENSMUSG00000022463
AA Change: T216A

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 118 137 N/A INTRINSIC
low complexity region 178 204 N/A INTRINSIC
low complexity region 210 235 N/A INTRINSIC
HLH 325 375 3.54e-15 SMART
low complexity region 383 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229009
AA Change: T186A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000229336
AA Change: T176A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231065
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display prenatal lethality. Mice homozygous for an ENU mutation display cataracts and persistent wounds of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I61N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Srebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Srebf2 APN 15 82192203 unclassified probably benign
IGL01409:Srebf2 APN 15 82171218 missense probably damaging 1.00
IGL01415:Srebf2 APN 15 82177462 missense probably benign 0.08
IGL01614:Srebf2 APN 15 82178853 missense probably benign
IGL01985:Srebf2 APN 15 82192359 missense probably benign 0.01
IGL02423:Srebf2 APN 15 82175097 missense probably damaging 1.00
IGL02436:Srebf2 APN 15 82197727 missense probably benign 0.41
IGL02805:Srebf2 APN 15 82169844 missense probably benign 0.00
IGL02818:Srebf2 APN 15 82185374 missense probably damaging 0.99
IGL02823:Srebf2 APN 15 82199774 missense possibly damaging 0.87
IGL02895:Srebf2 APN 15 82147467 missense possibly damaging 0.72
IGL03064:Srebf2 APN 15 82192222 missense probably benign 0.01
IGL03378:Srebf2 APN 15 82169788 missense probably damaging 1.00
FR4449:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4548:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4737:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4976:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
R0230:Srebf2 UTSW 15 82182085 missense probably damaging 1.00
R0702:Srebf2 UTSW 15 82177409 missense probably damaging 1.00
R0829:Srebf2 UTSW 15 82177589 critical splice donor site probably null
R1241:Srebf2 UTSW 15 82177519 missense probably damaging 1.00
R1898:Srebf2 UTSW 15 82203735 missense probably damaging 1.00
R1957:Srebf2 UTSW 15 82194954 missense probably benign 0.26
R2395:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R3771:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3772:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3773:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R4030:Srebf2 UTSW 15 82178783 missense probably damaging 1.00
R4613:Srebf2 UTSW 15 82185348 missense possibly damaging 0.94
R4670:Srebf2 UTSW 15 82192302 missense probably damaging 1.00
R4758:Srebf2 UTSW 15 82196169 missense probably benign 0.01
R4812:Srebf2 UTSW 15 82203825 missense probably damaging 0.98
R5058:Srebf2 UTSW 15 82182050 missense probably damaging 0.99
R5063:Srebf2 UTSW 15 82177451 missense probably benign
R5155:Srebf2 UTSW 15 82196226 missense probably damaging 1.00
R5166:Srebf2 UTSW 15 82185402 missense probably damaging 1.00
R5330:Srebf2 UTSW 15 82196208 missense possibly damaging 0.88
R5662:Srebf2 UTSW 15 82195003 missense probably benign 0.01
R5668:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R5867:Srebf2 UTSW 15 82169786 missense probably damaging 1.00
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6928:Srebf2 UTSW 15 82203723 nonsense probably null
X0064:Srebf2 UTSW 15 82175220 missense probably damaging 1.00
Z1088:Srebf2 UTSW 15 82194921 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGTTCCTTGCCCATGTAAC -3'
(R):5'- ATCGTATGTGTCAACAGTCACTG -3'

Sequencing Primer
(F):5'- GTAACTTTGCTCTCTTCTTCCCAAAG -3'
(R):5'- AGGCTCAGTCAGATCTCTGCAATG -3'
Posted On2016-09-06