Incidental Mutation 'R5398:Egfl8'
ID429820
Institutional Source Beutler Lab
Gene Symbol Egfl8
Ensembl Gene ENSMUSG00000015467
Gene NameEGF-like domain 8
SynonymsNG3
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5398 (G1)
Quality Score204
Status Validated
Chromosome17
Chromosomal Location34613349-34615971 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 34614639 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015611] [ENSMUST00000037489] [ENSMUST00000064953] [ENSMUST00000097345] [ENSMUST00000114140] [ENSMUST00000166040] [ENSMUST00000168353] [ENSMUST00000168391] [ENSMUST00000169067] [ENSMUST00000171121] [ENSMUST00000171376] [ENSMUST00000173242] [ENSMUST00000173973] [ENSMUST00000174041] [ENSMUST00000174228] [ENSMUST00000174595]
Predicted Effect probably benign
Transcript: ENSMUST00000015611
SMART Domains Protein: ENSMUSP00000015611
Gene: ENSMUSG00000015467

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:EMI 36 102 4.3e-20 PFAM
EGF 113 142 5.49e-3 SMART
EGF_CA 144 184 2.58e-8 SMART
coiled coil region 206 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037489
SMART Domains Protein: ENSMUSP00000048573
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 210 4.64e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064953
SMART Domains Protein: ENSMUSP00000068071
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097345
SMART Domains Protein: ENSMUSP00000094958
Gene: ENSMUSG00000015467

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:EMI 34 104 3e-16 PFAM
EGF 113 142 5.49e-3 SMART
EGF_CA 144 184 2.58e-8 SMART
coiled coil region 206 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114140
SMART Domains Protein: ENSMUSP00000109776
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 210 4.64e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166040
SMART Domains Protein: ENSMUSP00000132006
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 289 9e-19 PFAM
Pfam:Abhydrolase_1 37 173 9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168327
Predicted Effect probably benign
Transcript: ENSMUST00000168353
SMART Domains Protein: ENSMUSP00000128433
Gene: ENSMUSG00000015467

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:EMI 34 104 7.4e-16 PFAM
EGF 113 142 5.49e-3 SMART
EGF_CA 144 184 2.58e-8 SMART
coiled coil region 206 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168391
SMART Domains Protein: ENSMUSP00000132339
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168709
Predicted Effect probably benign
Transcript: ENSMUST00000169067
SMART Domains Protein: ENSMUSP00000127372
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169969
SMART Domains Protein: ENSMUSP00000127726
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:Abhydrolase_1 18 139 9e-8 PFAM
Pfam:Palm_thioest 116 234 1.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170850
Predicted Effect probably benign
Transcript: ENSMUST00000171121
SMART Domains Protein: ENSMUSP00000127745
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171376
SMART Domains Protein: ENSMUSP00000131243
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173146
Predicted Effect probably benign
Transcript: ENSMUST00000173242
SMART Domains Protein: ENSMUSP00000134242
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
Pfam:Acyltransferase 80 149 1.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173973
SMART Domains Protein: ENSMUSP00000133947
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174041
SMART Domains Protein: ENSMUSP00000133441
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 198 6.63e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174228
SMART Domains Protein: ENSMUSP00000133876
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174595
SMART Domains Protein: ENSMUSP00000134358
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 210 4.64e-42 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype PHENOTYPE: Homozygous null mice show no notable phenotype in a high-throughput phenotype screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I345N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 S374P probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Egfl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Egfl8 APN 17 34614916 missense probably damaging 1.00
R0278:Egfl8 UTSW 17 34614368 intron probably null
R0453:Egfl8 UTSW 17 34614882 missense probably damaging 1.00
R2268:Egfl8 UTSW 17 34613858 missense probably damaging 0.98
R2269:Egfl8 UTSW 17 34613858 missense probably damaging 0.98
R4923:Egfl8 UTSW 17 34614197 missense probably benign 0.20
Z1088:Egfl8 UTSW 17 34614241 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCTGCATTCATCGACATCTAG -3'
(R):5'- ACAGATATGAGCCTGCTTCTG -3'

Sequencing Primer
(F):5'- GCATTCATCGACATCTAGTTACCAG -3'
(R):5'- GTGTTCTAGGACCACATACCGTG -3'
Posted On2016-09-06