Incidental Mutation 'R5398:Pcdhb21'
ID429827
Institutional Source Beutler Lab
Gene Symbol Pcdhb21
Ensembl Gene ENSMUSG00000044022
Gene Nameprotocadherin beta 21
SynonymsPcdhb18, PcdhbU
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.031) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37513621-37518325 bp(+) (GRCm38)
Type of Mutationmissense (309302 bp from exon)
DNA Base Change (assembly) G to T at 37515719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 634 (V634L)
Ref Sequence ENSEMBL: ENSMUSP00000056424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000061405
AA Change: V634L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022
AA Change: V634L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097609
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192409
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr365 C A 2: 37,201,318 Q26K probably benign Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I345N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 S374P probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Pcdhb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pcdhb21 APN 18 37514553 missense probably damaging 1.00
IGL01860:Pcdhb21 APN 18 37514905 missense probably benign 0.00
IGL02139:Pcdhb21 APN 18 37515246 missense probably damaging 1.00
IGL02370:Pcdhb21 APN 18 37514592 unclassified probably null
IGL03108:Pcdhb21 APN 18 37515891 unclassified probably null
IGL03265:Pcdhb21 APN 18 37515153 missense probably damaging 1.00
R0454:Pcdhb21 UTSW 18 37514513 missense probably damaging 1.00
R0519:Pcdhb21 UTSW 18 37516032 missense possibly damaging 0.95
R0647:Pcdhb21 UTSW 18 37513860 missense probably damaging 0.99
R0689:Pcdhb21 UTSW 18 37515317 missense probably benign 0.00
R1607:Pcdhb21 UTSW 18 37515479 missense probably damaging 1.00
R1649:Pcdhb21 UTSW 18 37515613 missense probably damaging 1.00
R1777:Pcdhb21 UTSW 18 37515718 missense possibly damaging 0.80
R1865:Pcdhb21 UTSW 18 37514595 missense possibly damaging 0.95
R4595:Pcdhb21 UTSW 18 37514515 missense probably damaging 1.00
R4888:Pcdhb21 UTSW 18 37515077 missense possibly damaging 0.76
R5281:Pcdhb21 UTSW 18 37513935 missense probably benign 0.00
R5396:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5399:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5635:Pcdhb21 UTSW 18 37513917 missense probably benign 0.33
R6134:Pcdhb21 UTSW 18 37514408 missense probably benign 0.03
R6387:Pcdhb21 UTSW 18 37515332 missense probably benign 0.35
R6595:Pcdhb21 UTSW 18 37515908 missense probably damaging 1.00
R6750:Pcdhb21 UTSW 18 37514448 missense probably damaging 1.00
R6754:Pcdhb21 UTSW 18 37514683 missense probably benign 0.28
R6928:Pcdhb21 UTSW 18 37514421 missense probably damaging 1.00
Z1088:Pcdhb21 UTSW 18 37514541 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAATGACAATGCGCCCTTCG -3'
(R):5'- AATAGAGTGTGAGCGCTTCC -3'

Sequencing Primer
(F):5'- GTGCTCTACCCGATGCAGAAC -3'
(R):5'- AATAGAGTGTGAGCGCTTCCTCATC -3'
Posted On2016-09-06