Incidental Mutation 'R5402:Car9'
ID430031
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Namecarbonic anhydrase 9
SynonymsCAIX, MN/CA9
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43506966-43513729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43510213 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 265 (N265S)
Ref Sequence ENSEMBL: ENSMUSP00000030183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183] [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914]
Predicted Effect probably damaging
Transcript: ENSMUST00000030183
AA Change: N265S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463
AA Change: N265S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect unknown
Transcript: ENSMUST00000138073
AA Change: N179S
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463
AA Change: N179S

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43512941 splice site probably benign
IGL01893:Car9 APN 4 43510252 missense probably damaging 1.00
IGL02064:Car9 APN 4 43507363 missense probably benign
R0122:Car9 UTSW 4 43512206 missense probably benign 0.05
R0314:Car9 UTSW 4 43509212 critical splice donor site probably null
R0497:Car9 UTSW 4 43511881 missense probably damaging 1.00
R1018:Car9 UTSW 4 43512439 critical splice donor site probably null
R1132:Car9 UTSW 4 43512439 critical splice donor site probably null
R1218:Car9 UTSW 4 43512439 critical splice donor site probably null
R1219:Car9 UTSW 4 43512439 critical splice donor site probably null
R1222:Car9 UTSW 4 43512439 critical splice donor site probably null
R1350:Car9 UTSW 4 43512439 critical splice donor site probably null
R1351:Car9 UTSW 4 43512439 critical splice donor site probably null
R1352:Car9 UTSW 4 43512439 critical splice donor site probably null
R1353:Car9 UTSW 4 43512439 critical splice donor site probably null
R1389:Car9 UTSW 4 43512439 critical splice donor site probably null
R1417:Car9 UTSW 4 43512439 critical splice donor site probably null
R1470:Car9 UTSW 4 43510222 missense probably damaging 1.00
R1470:Car9 UTSW 4 43510222 missense probably damaging 1.00
R1573:Car9 UTSW 4 43512439 critical splice donor site probably null
R1818:Car9 UTSW 4 43512439 critical splice donor site probably null
R1819:Car9 UTSW 4 43512439 critical splice donor site probably null
R4033:Car9 UTSW 4 43508624 missense possibly damaging 0.52
R4597:Car9 UTSW 4 43509138 missense probably damaging 1.00
R4609:Car9 UTSW 4 43507267 missense possibly damaging 0.81
R4719:Car9 UTSW 4 43508616 nonsense probably null
R5624:Car9 UTSW 4 43509146 missense probably benign 0.03
R6471:Car9 UTSW 4 43511938 missense probably damaging 1.00
R6850:Car9 UTSW 4 43507321 missense probably damaging 0.96
X0067:Car9 UTSW 4 43507198 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CAGCCTGGGAAACTTTCTCC -3'
(R):5'- CTGTGGACAGTAGTTTCCCTATCC -3'

Sequencing Primer
(F):5'- GGGAAACTTTCTCCCCTTCAG -3'
(R):5'- GACAGTAGTTTCCCTATCCCCTGTG -3'
Posted On2016-09-06