Incidental Mutation 'R5402:Cyp2d34'
ID430074
Institutional Source Beutler Lab
Gene Symbol Cyp2d34
Ensembl Gene ENSMUSG00000094559
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 34
Synonyms
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82615965-82620946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82619086 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 69 (G69D)
Ref Sequence ENSEMBL: ENSMUSP00000105141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109515] [ENSMUST00000229833]
Predicted Effect probably damaging
Transcript: ENSMUST00000109515
AA Change: G69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105141
Gene: ENSMUSG00000094559
AA Change: G69D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 3.2e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231012
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Cyp2d34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Cyp2d34 APN 15 82617535 missense probably damaging 0.96
IGL00914:Cyp2d34 APN 15 82620714 missense probably damaging 0.98
IGL01347:Cyp2d34 APN 15 82616777 missense possibly damaging 0.89
IGL01354:Cyp2d34 APN 15 82617622 missense probably benign 0.00
IGL01681:Cyp2d34 APN 15 82617131 critical splice donor site probably null
IGL01733:Cyp2d34 APN 15 82618660 missense possibly damaging 0.73
IGL02231:Cyp2d34 APN 15 82618606 missense probably benign 0.44
IGL02425:Cyp2d34 APN 15 82618279 missense probably benign
IGL03219:Cyp2d34 APN 15 82618539 missense probably benign 0.01
R0684:Cyp2d34 UTSW 15 82617550 missense probably benign 0.06
R0811:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R0812:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R1617:Cyp2d34 UTSW 15 82620845 missense probably benign 0.21
R1756:Cyp2d34 UTSW 15 82617524 missense probably damaging 1.00
R1827:Cyp2d34 UTSW 15 82616094 missense probably benign 0.00
R1962:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R2102:Cyp2d34 UTSW 15 82616773 missense probably benign 0.17
R2113:Cyp2d34 UTSW 15 82617616 missense probably damaging 1.00
R2432:Cyp2d34 UTSW 15 82619011 missense probably damaging 1.00
R2566:Cyp2d34 UTSW 15 82616167 missense probably damaging 1.00
R3154:Cyp2d34 UTSW 15 82617566 missense probably benign 0.04
R3834:Cyp2d34 UTSW 15 82616746 critical splice donor site probably null
R3881:Cyp2d34 UTSW 15 82618617 missense probably benign 0.00
R4022:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R4181:Cyp2d34 UTSW 15 82617285 splice site probably null
R4613:Cyp2d34 UTSW 15 82616325 missense probably damaging 0.98
R4636:Cyp2d34 UTSW 15 82620728 missense probably damaging 1.00
R4695:Cyp2d34 UTSW 15 82616891 missense probably benign
R4993:Cyp2d34 UTSW 15 82618329 missense probably damaging 1.00
R5262:Cyp2d34 UTSW 15 82618371 missense probably damaging 1.00
R5772:Cyp2d34 UTSW 15 82617140 missense probably null 0.24
R5874:Cyp2d34 UTSW 15 82619042 missense probably benign 0.04
R6051:Cyp2d34 UTSW 15 82616770 missense probably damaging 1.00
R6057:Cyp2d34 UTSW 15 82616351 missense probably benign
R6143:Cyp2d34 UTSW 15 82620776 missense probably benign 0.25
R6452:Cyp2d34 UTSW 15 82616089 missense probably benign 0.00
R7296:Cyp2d34 UTSW 15 82617235 missense possibly damaging 0.87
R7391:Cyp2d34 UTSW 15 82618386 missense probably benign 0.14
R7398:Cyp2d34 UTSW 15 82616763 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCACACAGCTCTTTACCTTGGG -3'
(R):5'- GACCTACTTGAGATCCAGTTCTGAC -3'

Sequencing Primer
(F):5'- GGGATTTGCTCTTAAAACCTAGG -3'
(R):5'- CTGACTTCCTTTGGTAATGAACAGC -3'
Posted On2016-09-06