Incidental Mutation 'R5403:Zfp607a'
ID430100
Institutional Source Beutler Lab
Gene Symbol Zfp607a
Ensembl Gene ENSMUSG00000020420
Gene Namezinc finger protein 607A
SynonymsZfp607, 4732475C15Rik
MMRRC Submission 042974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5403 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27857527-27880825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27879319 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 605 (K605E)
Ref Sequence ENSEMBL: ENSMUSP00000146006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053722] [ENSMUST00000205534] [ENSMUST00000205715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053722
AA Change: K605E

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051496
Gene: ENSMUSG00000020420
AA Change: K605E

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.91e-2 SMART
ZnF_C2H2 201 223 3.44e-4 SMART
ZnF_C2H2 229 251 3.83e-2 SMART
ZnF_C2H2 257 279 4.87e-4 SMART
ZnF_C2H2 285 307 1.38e-3 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 2.86e-1 SMART
ZnF_C2H2 369 391 5.14e-3 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 4.47e-3 SMART
ZnF_C2H2 453 475 1.1e-2 SMART
ZnF_C2H2 481 503 1.45e-2 SMART
ZnF_C2H2 509 531 1.12e-3 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 8.34e-3 SMART
ZnF_C2H2 593 615 1.12e-3 SMART
ZnF_C2H2 621 643 6.42e-4 SMART
ZnF_C2H2 649 671 6.23e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205534
AA Change: K605E

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205715
AA Change: K605E

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206136
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Adamts6 A G 13: 104,352,815 D392G possibly damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Alkbh8 A G 9: 3,385,318 K537E probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Bpifb4 A T 2: 153,943,992 I17F probably damaging Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Ccdc88b T A 19: 6,857,740 T38S unknown Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Cdr2 G A 7: 120,958,745 Q186* probably null Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntnap3 G A 13: 64,761,978 T771I possibly damaging Het
Cops8 C T 1: 90,606,620 probably benign Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Ddx50 A G 10: 62,647,030 S87P probably benign Het
Dlg2 A G 7: 92,431,002 T598A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epha6 A T 16: 59,775,570 D919E probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fndc9 C T 11: 46,237,714 S20L probably benign Het
Gpx6 A G 13: 21,317,643 E145G probably damaging Het
Hc A G 2: 35,057,434 Y23H probably damaging Het
Jmy G T 13: 93,441,396 Q755K probably benign Het
Krtap4-7 A T 11: 99,643,714 S108T unknown Het
Mgat5b T G 11: 116,948,657 I333S probably benign Het
Mkl2 A G 16: 13,401,013 T519A probably damaging Het
Naip6 G A 13: 100,300,077 A646V probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Olfr936 G T 9: 39,046,703 P239T probably damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otogl T A 10: 107,808,756 M1210L probably benign Het
Phf24 A T 4: 42,933,831 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Rad50 A G 11: 53,695,281 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
St5 A G 7: 109,556,905 S213P probably damaging Het
Tbcd C A 11: 121,560,743 N546K probably damaging Het
Tenm4 A G 7: 96,888,827 D1832G probably damaging Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ube2o A T 11: 116,548,807 I179N possibly damaging Het
Usp17le T C 7: 104,769,234 I234V probably damaging Het
Zfp106 T C 2: 120,534,781 T382A probably benign Het
Zmynd10 T A 9: 107,550,586 L363H possibly damaging Het
Other mutations in Zfp607a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Zfp607a APN 7 27877789 missense possibly damaging 0.55
IGL01019:Zfp607a APN 7 27878617 missense probably damaging 1.00
IGL01412:Zfp607a APN 7 27878684 missense probably damaging 0.99
IGL03206:Zfp607a APN 7 27877823 missense possibly damaging 0.52
R0071:Zfp607a UTSW 7 27878269 missense probably damaging 0.96
R0304:Zfp607a UTSW 7 27879212 missense possibly damaging 0.92
R0685:Zfp607a UTSW 7 27878476 missense probably damaging 0.97
R0726:Zfp607a UTSW 7 27879149 missense probably benign 0.00
R1201:Zfp607a UTSW 7 27879311 missense probably damaging 1.00
R1304:Zfp607a UTSW 7 27865575 missense probably benign 0.00
R1648:Zfp607a UTSW 7 27879068 missense probably benign 0.02
R1732:Zfp607a UTSW 7 27878459 missense probably damaging 1.00
R2194:Zfp607a UTSW 7 27879380 missense possibly damaging 0.73
R3793:Zfp607a UTSW 7 27878906 missense probably benign 0.01
R3808:Zfp607a UTSW 7 27879401 missense probably benign 0.01
R4296:Zfp607a UTSW 7 27865648 missense probably damaging 1.00
R4786:Zfp607a UTSW 7 27879413 missense probably damaging 1.00
R4792:Zfp607a UTSW 7 27878653 missense probably benign 0.23
R4915:Zfp607a UTSW 7 27878560 missense probably benign 0.00
R4950:Zfp607a UTSW 7 27878751 missense probably damaging 1.00
R5123:Zfp607a UTSW 7 27879098 missense probably damaging 1.00
R5217:Zfp607a UTSW 7 27877844 missense probably damaging 0.97
R5270:Zfp607a UTSW 7 27878305 nonsense probably null
R6010:Zfp607a UTSW 7 27877829 nonsense probably null
R6224:Zfp607a UTSW 7 27878582 missense probably damaging 1.00
R6939:Zfp607a UTSW 7 27879048 nonsense probably null
R6953:Zfp607a UTSW 7 27878365 missense possibly damaging 0.59
R7082:Zfp607a UTSW 7 27878758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCCATGCCGGTTTGAAAC -3'
(R):5'- TAGTGGTATTGAAAGGCTTCCC -3'

Sequencing Primer
(F):5'- GTGGGAAAGCTTTTAATCATCGCTC -3'
(R):5'- GGTATTGAAAGGCTTCCCCACATTTG -3'
Posted On2016-09-06