Incidental Mutation 'R4808:Hjurp'
ID430148
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
MMRRC Submission 042427-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4808 (G1)
Quality Score27
Status Validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to C at 88277215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000065420] [ENSMUST00000147393]
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148138
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Adora2a A G 10: 75,333,446 N248S probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp26a1 A G 19: 37,701,125 H423R probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Oprd1 G A 4: 132,117,394 T101M probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pias4 A G 10: 81,155,840 probably null Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Pramel5 G A 4: 144,272,755 A254V probably benign Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rbm19 T C 5: 120,118,774 S51P probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Snap25 A G 2: 136,770,102 D70G probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Steap1 G T 5: 5,738,829 probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTAGCTCGAACTTCCATGCCAG -3'
(R):5'- AAAGCAGTAGCCGCTTCCAG -3'

Sequencing Primer
(F):5'- ACTCAGGGATTCAAGGTC -3'
(R):5'- AGTAGCCGCTTCCAGACGTTAATG -3'
Posted On2016-09-07