Incidental Mutation 'R4900:Flt1'
ID430154
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission 042504-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4900 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 147683939 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 132 (A132S)
Ref Sequence ENSEMBL: ENSMUSP00000106158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653] [ENSMUST00000110529]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031652
SMART Domains Protein: ENSMUSP00000031652
Gene: ENSMUSG00000029648

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
Pfam:Ig_2 434 511 9.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031653
AA Change: A132S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: A132S

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110529
AA Change: A132S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106158
Gene: ENSMUSG00000029648
AA Change: A132S

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
Meta Mutation Damage Score 0.0472 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,918,110 V262A probably benign Het
Abtb2 A G 2: 103,567,004 E93G possibly damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adgrb2 T A 4: 130,013,875 Y1001N probably damaging Het
Aox2 T G 1: 58,305,385 S546A probably benign Het
Asic2 T C 11: 81,573,454 probably benign Het
Bcl11b T A 12: 107,989,698 N64I probably damaging Het
Cacna1g A G 11: 94,459,351 F556S possibly damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdh11 C T 8: 102,647,458 probably null Het
Ces2g C T 8: 104,967,357 Q442* probably null Het
Cps1 A T 1: 67,160,904 T404S probably damaging Het
Csf2rb2 A T 15: 78,285,974 probably null Het
Csmd2 A G 4: 128,452,525 Y1526C probably benign Het
Cyp2a12 C T 7: 27,031,215 Q202* probably null Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Cyp2j13 G A 4: 96,059,043 T257I probably damaging Het
Dnah8 T A 17: 30,746,975 L2427Q probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Flvcr2 T A 12: 85,782,982 V255D probably damaging Het
Galc G T 12: 98,231,472 T326K probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gen1 A T 12: 11,241,560 Y808N probably benign Het
Glis1 C T 4: 107,619,564 A306V probably damaging Het
Gm10638 A G 8: 86,746,400 probably benign Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gm1966 T G 7: 106,598,586 noncoding transcript Het
Gm27048 C T 8: 80,934,599 noncoding transcript Het
Gm4204 T C 1: 135,232,818 noncoding transcript Het
Gm904 A T 13: 50,645,289 I95F possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ints11 G A 4: 155,888,430 D526N probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Kcnj8 A G 6: 142,566,495 S129P probably damaging Het
Kcnq3 A G 15: 65,995,410 S795P probably damaging Het
Lhx8 G T 3: 154,330,288 A22E probably benign Het
Lrp8 A G 4: 107,806,809 probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Lvrn T C 18: 46,881,412 S526P probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mroh8 T C 2: 157,228,727 E568G probably benign Het
Ms4a4b C A 19: 11,463,139 probably benign Het
Muc2 T C 7: 141,749,543 F99S probably benign Het
Myo5c T A 9: 75,273,543 I738N probably damaging Het
Naip6 A C 13: 100,296,969 V1120G probably damaging Het
Ncl T C 1: 86,356,179 T307A probably benign Het
Npr1 A T 3: 90,455,965 D869E possibly damaging Het
Nup93 A G 8: 94,286,603 T36A probably benign Het
Olfml2b C A 1: 170,662,378 T189N probably damaging Het
Olfr1255 A G 2: 89,816,968 N208S possibly damaging Het
Olfr877 T C 9: 37,855,312 F165L probably benign Het
P4htm A C 9: 108,579,228 W458G probably damaging Het
Pdzrn4 G T 15: 92,770,757 R930L probably damaging Het
Pgam5 G A 5: 110,260,435 A240V probably damaging Het
Prex2 T C 1: 11,149,905 probably benign Het
Ptpru T G 4: 131,788,382 E897A probably damaging Het
Rapgef2 A T 3: 79,074,363 N1256K probably benign Het
Rhbdl3 A G 11: 80,319,613 E64G probably benign Het
Sel1l3 A T 5: 53,131,842 L879Q probably damaging Het
Siah1a G T 8: 86,725,075 D260E probably benign Het
Skint6 T C 4: 113,067,470 I522V probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Smok3c T C 5: 138,064,551 I100T probably damaging Het
Snx24 C A 18: 53,385,223 Y141* probably null Het
Tigit A G 16: 43,649,231 S166P probably damaging Het
Tmem183a C T 1: 134,348,166 R324Q probably benign Het
Tmie T C 9: 110,866,933 D130G possibly damaging Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Vmn2r111 T C 17: 22,548,656 N620S possibly damaging Het
Vmn2r12 T A 5: 109,092,986 N87I probably damaging Het
Vmn2r92 A G 17: 18,184,343 D583G probably benign Het
Zdhhc17 T C 10: 110,985,958 D60G possibly damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACGAGTCTACTGAGAAGCCC -3'
(R):5'- AGAAACTACACTGCTTTGGGG -3'

Sequencing Primer
(F):5'- GCCCAGAGAGAAAGTTTTTCC -3'
(R):5'- ACTACACTGCTTTGGGGGACAG -3'
Posted On2016-09-07