Incidental Mutation 'R4836:Dpep1'
ID430171
Institutional Source Beutler Lab
Gene Symbol Dpep1
Ensembl Gene ENSMUSG00000019278
Gene Namedipeptidase 1 (renal)
SynonymsMBD
MMRRC Submission 042451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R4836 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123186242-123201812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123200367 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 285 (D285G)
Ref Sequence ENSEMBL: ENSMUSP00000019422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000759] [ENSMUST00000019422] [ENSMUST00000127664] [ENSMUST00000212409] [ENSMUST00000212773]
Predicted Effect probably benign
Transcript: ENSMUST00000000759
SMART Domains Protein: ENSMUSP00000000759
Gene: ENSMUSG00000000743

DomainStartEndE-ValueType
Pfam:Snf7 4 174 6.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000019422
AA Change: D285G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019422
Gene: ENSMUSG00000019278
AA Change: D285G

DomainStartEndE-ValueType
Pfam:Peptidase_M19 25 352 4.1e-122 PFAM
low complexity region 398 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212409
Predicted Effect probably benign
Transcript: ENSMUST00000212773
Meta Mutation Damage Score 0.472 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kidney membrane enzyme involved in the metabolism of glutathione and other similar proteins by dipeptide hydrolysis. The encoded protein is known to regulate leukotriene activity by catalyzing the conversion of leukotriene D4 to leukotriene E4. This protein uses zinc as a cofactor and acts as a disulfide-linked homodimer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for disruption of this gene ar phenotypically normal although defects have been noted in the conversion of leukotriene D4 to leukotrience E4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,108 I1051T probably benign Het
Acox1 A T 11: 116,175,326 S453T probably benign Het
AF366264 C T 8: 13,838,007 S28N probably benign Het
Ahnak2 A T 12: 112,774,116 V368D probably damaging Het
Ankrd53 A T 6: 83,768,152 Y448F probably damaging Het
Arhgef15 A T 11: 68,949,925 probably benign Het
Atg2b T C 12: 105,646,814 N1166S probably benign Het
Atl3 C T 19: 7,509,545 R77* probably null Het
Bend6 T C 1: 33,883,573 probably benign Het
Ccnt1 C A 15: 98,567,563 R25L probably damaging Het
Cct4 A G 11: 23,002,898 T525A probably benign Het
Cep350 T C 1: 155,928,833 I835V probably damaging Het
Clcn1 G T 6: 42,309,964 V652L probably damaging Het
Cntln T A 4: 85,049,720 Y725* probably null Het
Cog5 T C 12: 31,919,733 F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,111,424 probably benign Het
Dnm2 A T 9: 21,491,330 probably benign Het
Dnmt1 C T 9: 20,908,558 V1430I probably damaging Het
Eef2kmt C T 16: 5,249,003 V129M probably damaging Het
Epha3 A T 16: 63,583,557 M726K probably damaging Het
Fat3 A G 9: 16,377,723 L168P probably damaging Het
Frem3 T A 8: 80,663,397 F1759Y probably damaging Het
Fubp3 T A 2: 31,608,141 S56R possibly damaging Het
Gm1965 T C 6: 89,145,410 noncoding transcript Het
Gm5592 C T 7: 41,215,534 probably benign Het
Hils1 T A 11: 94,968,017 L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Isl1 A G 13: 116,303,083 M243T probably benign Het
Itpr1 A T 6: 108,389,537 I142F probably damaging Het
Jak1 T C 4: 101,155,066 T1069A probably damaging Het
Jmjd1c T C 10: 67,233,446 V1848A probably benign Het
Kdm5a T C 6: 120,412,402 V930A probably damaging Het
Kdm5b C A 1: 134,593,315 probably null Het
Lexm T A 4: 106,610,527 probably null Het
Lilra5 T C 7: 4,238,714 F171L possibly damaging Het
Map1b A G 13: 99,431,054 S1720P unknown Het
Mcpt1 A T 14: 56,019,560 Q185L probably damaging Het
Mmp20 T A 9: 7,644,026 D238E possibly damaging Het
Mov10l1 A T 15: 89,020,269 I784F possibly damaging Het
Mroh2b C T 15: 4,904,270 P101S probably damaging Het
Myh3 G T 11: 67,096,939 A1413S probably benign Het
Nat6 A T 9: 107,583,539 Y211F probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1009 A G 2: 85,721,449 I15V probably benign Het
Olfr1054 A T 2: 86,333,227 M43K probably benign Het
Olfr1056 G A 2: 86,355,750 L211F probably benign Het
Olfr1196 A G 2: 88,701,200 I43T probably damaging Het
Olfr330 A C 11: 58,529,482 M168R probably damaging Het
Olfr533 A G 7: 140,467,076 R292G probably damaging Het
Palld T A 8: 61,687,381 T531S probably benign Het
Parp4 A G 14: 56,585,738 E105G probably benign Het
Phf11a A T 14: 59,287,579 S59T probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad50 A T 11: 53,650,653 I1252N probably damaging Het
Ramp3 A G 11: 6,674,761 probably null Het
Rrbp1 G A 2: 143,988,417 T610I possibly damaging Het
Slc4a10 A G 2: 62,268,187 Y555C probably damaging Het
Slc5a2 A G 7: 128,267,505 probably null Het
Smoc1 T A 12: 81,179,548 D371E probably damaging Het
Stmn1 T A 4: 134,470,184 probably benign Het
Sulf1 C T 1: 12,842,686 L715F probably benign Het
Surf1 T C 2: 26,914,243 T180A possibly damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A T 3: 93,445,148 R632W unknown Het
Tchh A T 3: 93,447,588 D1445V unknown Het
Tctn1 A T 5: 122,245,505 M505K probably benign Het
Tdrkh T A 3: 94,425,590 I150N probably damaging Het
Tespa1 C T 10: 130,362,159 T350I probably benign Het
Thbs1 A G 2: 118,115,018 Y326C possibly damaging Het
Tmem208 C T 8: 105,328,664 S119F probably damaging Het
Tmprss6 G C 15: 78,445,388 A91G probably damaging Het
Trp53bp2 C T 1: 182,431,582 R67W probably damaging Het
Ttn A G 2: 76,711,197 I25488T possibly damaging Het
Txnl4a A G 18: 80,222,253 E111G probably damaging Het
Unc13b T G 4: 43,237,137 I3402M probably damaging Het
Vmn1r188 A C 13: 22,088,121 I82L probably benign Het
Zfp65 A G 13: 67,708,875 V95A probably benign Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Other mutations in Dpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Dpep1 APN 8 123199615 splice site probably benign
IGL02354:Dpep1 APN 8 123200218 missense probably benign
IGL02361:Dpep1 APN 8 123200218 missense probably benign
IGL02527:Dpep1 APN 8 123198748 missense probably damaging 1.00
IGL02723:Dpep1 APN 8 123194149 missense possibly damaging 0.95
R0190:Dpep1 UTSW 8 123200708 missense probably benign 0.21
R1348:Dpep1 UTSW 8 123199160 missense probably benign 0.02
R1719:Dpep1 UTSW 8 123200747 missense possibly damaging 0.67
R2060:Dpep1 UTSW 8 123200391 missense probably damaging 0.99
R2081:Dpep1 UTSW 8 123199378 missense probably damaging 0.97
R2279:Dpep1 UTSW 8 123194144 missense probably benign 0.04
R3931:Dpep1 UTSW 8 123198779 missense possibly damaging 0.73
R4027:Dpep1 UTSW 8 123194153 missense probably benign 0.12
R5007:Dpep1 UTSW 8 123199378 missense probably damaging 0.97
R5149:Dpep1 UTSW 8 123200438 missense probably benign 0.01
R5268:Dpep1 UTSW 8 123194089 missense probably benign 0.12
R5774:Dpep1 UTSW 8 123199982 missense probably damaging 1.00
R6041:Dpep1 UTSW 8 123200655 missense probably damaging 0.99
R6335:Dpep1 UTSW 8 123200652 missense probably damaging 1.00
T0975:Dpep1 UTSW 8 123200988 missense probably damaging 0.99
X0005:Dpep1 UTSW 8 123200988 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACTGCAGCTGGTGGTAAG -3'
(R):5'- TACTCAGGACACGTTCTCCC -3'

Sequencing Primer
(F):5'- CCTGGGGGTCCTCTCTAAC -3'
(R):5'- CTCCCCTGTCCCATCGGG -3'
Posted On2016-09-07