Incidental Mutation 'R4929:Dym'
ID430280
Institutional Source Beutler Lab
Gene Symbol Dym
Ensembl Gene ENSMUSG00000035765
Gene Namedymeclin
SynonymsC030019K18Rik, 4933427L07Rik, 1810041M12Rik
MMRRC Submission 042530-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4929 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location75018772-75286966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75243286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 583 (V583E)
Ref Sequence ENSEMBL: ENSMUSP00000047054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039608]
Predicted Effect probably damaging
Transcript: ENSMUST00000039608
AA Change: V583E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047054
Gene: ENSMUSG00000035765
AA Change: V583E

DomainStartEndE-ValueType
Pfam:Dymeclin 1 646 3.3e-174 PFAM
Pfam:Hid1 309 584 3e-11 PFAM
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is necessary for normal skeletal development and brain function. Mutations in this gene are associated with two types of recessive osteochondrodysplasia, Dyggve-Melchior-Clausen (DMC) dysplasia and Smith-McCort (SMC) dysplasia, which involve both skeletal defects and mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele display decreased body size with short tubular bones, chondrodysplasia, partial penetrance of obstructive hydronephrosis and impaired vesicular transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,574,042 noncoding transcript Het
Abcd3 A T 3: 121,768,746 probably null Het
Adamts12 C T 15: 11,259,022 R551C probably damaging Het
Adamtsl4 A G 3: 95,678,005 C818R probably damaging Het
Arfgef3 T A 10: 18,630,851 Q842L probably benign Het
Aurka A T 2: 172,370,406 V17E probably benign Het
Ccdc144b G A 3: 36,035,338 L146F probably damaging Het
Cdh24 C T 14: 54,633,516 V132I probably benign Het
Cep57l1 T C 10: 41,745,914 D2G possibly damaging Het
Cntn5 T A 9: 9,976,395 probably null Het
Col10a1 T C 10: 34,395,124 I364T probably benign Het
Dpp6 G A 5: 27,049,787 A67T probably benign Het
Efcab5 T G 11: 77,103,383 K1259N probably benign Het
Ehbp1 T G 11: 22,239,169 I78L possibly damaging Het
Epha1 C A 6: 42,364,599 A469S probably benign Het
Fam135a T C 1: 24,030,000 D596G probably benign Het
Filip1 T C 9: 79,819,747 N530S probably benign Het
Grhl2 A G 15: 37,360,802 N610S probably benign Het
Haus6 T C 4: 86,595,433 I331V probably benign Het
Ints2 G T 11: 86,212,653 N1192K possibly damaging Het
Itga5 A G 15: 103,353,235 V445A probably benign Het
Itga9 C A 9: 118,807,249 D82E probably damaging Het
Jam2 G A 16: 84,822,862 probably benign Het
Klhl32 T A 4: 24,709,030 I112F probably damaging Het
Lepr A G 4: 101,815,117 I1113V probably benign Het
Lrrc3b C A 14: 15,357,888 L239F probably damaging Het
Lzic T A 4: 149,488,128 probably null Het
Mxra8 T A 4: 155,842,661 F351I probably damaging Het
Naa40 A G 19: 7,229,982 F126L probably damaging Het
Nbeal1 C T 1: 60,238,654 S733F probably damaging Het
Olfr183 A C 16: 59,000,219 Y178S probably damaging Het
Olfr259 A G 2: 87,108,183 F68S possibly damaging Het
Olfr686 A G 7: 105,204,025 I106T probably damaging Het
Olr1 T C 6: 129,500,081 T74A probably damaging Het
Pgam5 A T 5: 110,265,825 V130D probably damaging Het
Pop4 A G 7: 38,266,149 C115R probably damaging Het
Prpf18 A T 2: 4,624,537 probably null Het
Psg16 G A 7: 17,095,106 R205H possibly damaging Het
Ptgr1 C A 4: 58,981,879 A53S probably benign Het
Shank2 A G 7: 144,411,271 D1451G probably benign Het
Slfn10-ps A G 11: 83,029,519 noncoding transcript Het
Sox8 G A 17: 25,570,356 A56V probably benign Het
Ssr3 A G 3: 65,387,754 S113P probably damaging Het
Stx16 T C 2: 174,096,928 Y296H possibly damaging Het
Tfcp2 A T 15: 100,528,489 N60K probably benign Het
Thada T C 17: 84,444,226 T441A probably benign Het
Trf G T 9: 103,227,875 probably benign Het
Vamp2 T A 11: 69,088,662 probably benign Het
Vmn2r105 A T 17: 20,228,018 D181E probably benign Het
Vmn2r12 A T 5: 109,091,678 Y340N probably damaging Het
Wasf2 C A 4: 133,195,859 D493E unknown Het
Wdfy4 T C 14: 33,047,256 D2084G possibly damaging Het
Zfp229 T A 17: 21,746,373 I528N probably damaging Het
Zfp703 T A 8: 26,978,851 V181E possibly damaging Het
Other mutations in Dym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Dym APN 18 75119249 missense probably benign 0.43
IGL01593:Dym APN 18 75114781 splice site probably benign
IGL02657:Dym APN 18 75082456 nonsense probably null
IGL02716:Dym APN 18 75286683 missense probably damaging 1.00
IGL02977:Dym APN 18 75063175 critical splice donor site probably null
asesino UTSW 18 75056641 missense probably damaging 1.00
flavor UTSW 18 75056738 nonsense probably null
sabor UTSW 18 75125539 critical splice donor site probably null
R0042:Dym UTSW 18 75125539 critical splice donor site probably null
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0320:Dym UTSW 18 75199262 missense probably damaging 0.99
R0943:Dym UTSW 18 75286769 makesense probably null
R1677:Dym UTSW 18 75125512 missense probably damaging 1.00
R2022:Dym UTSW 18 75080250 missense probably benign 0.05
R2221:Dym UTSW 18 75230165 missense probably damaging 1.00
R2292:Dym UTSW 18 75199212 missense possibly damaging 0.95
R4087:Dym UTSW 18 75230101 missense probably damaging 1.00
R5033:Dym UTSW 18 75119161 missense possibly damaging 0.78
R6489:Dym UTSW 18 75080226 missense probably benign 0.27
R6641:Dym UTSW 18 75056641 missense probably damaging 1.00
R6751:Dym UTSW 18 75286647 missense probably damaging 0.98
R6864:Dym UTSW 18 75056738 nonsense probably null
R7284:Dym UTSW 18 75119171 missense possibly damaging 0.60
R7319:Dym UTSW 18 75063174 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCAGCAACTTCGTGGTTC -3'
(R):5'- TCTCTATGTGCCTTGAGTGACC -3'

Sequencing Primer
(F):5'- CAGCAACTTCGTGGTTCAATCTATG -3'
(R):5'- CTATGTGCCTTGAGTGACCAACAG -3'
Posted On2016-10-05