Incidental Mutation 'R5484:Pms2'
ID430300
Institutional Source Beutler Lab
Gene Symbol Pms2
Ensembl Gene ENSMUSG00000079109
Gene NamePMS1 homolog2, mismatch repair system component
Synonymsmismatch repair, DNA mismatch repair
MMRRC Submission 043045-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R5484 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143909964-143933968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143928125 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 675 (I675T)
Ref Sequence ENSEMBL: ENSMUSP00000119875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999] [ENSMUST00000166847]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110707
Predicted Effect probably benign
Transcript: ENSMUST00000110709
AA Change: I277T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109
AA Change: I277T

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
MutL_C 277 421 1.59e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141942
Predicted Effect probably damaging
Transcript: ENSMUST00000148011
AA Change: I675T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: I675T

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
DNA_mis_repair 227 364 4.76e-41 SMART
MutL_C 675 819 1.59e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164999
SMART Domains Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
DNA_mis_repair 1 70 4.47e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166847
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170083
Predicted Effect probably benign
Transcript: ENSMUST00000172367
SMART Domains Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633

DomainStartEndE-ValueType
MutL_C 5 139 1.78e-1 SMART
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Abca6 A T 11: 110,184,073 V1388E probably damaging Het
Alx1 T A 10: 103,025,316 D117V probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Cttnbp2 T A 6: 18,427,690 probably benign Het
Dmxl1 T A 18: 49,889,464 V1623E probably damaging Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Plxnb2 T C 15: 89,164,209 probably null Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc13a2 G A 11: 78,404,822 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Strip2 C A 6: 29,917,155 probably benign Het
Tbx4 A G 11: 85,914,404 T440A probably damaging Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Pms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Pms2 APN 5 143923519 missense probably damaging 1.00
IGL02009:Pms2 APN 5 143925764 missense probably benign 0.42
IGL02801:Pms2 APN 5 143925835 missense probably benign 0.06
P0047:Pms2 UTSW 5 143919598 missense probably damaging 1.00
R1367:Pms2 UTSW 5 143925913 missense probably damaging 1.00
R1422:Pms2 UTSW 5 143913705 missense probably damaging 1.00
R1854:Pms2 UTSW 5 143925896 missense probably benign 0.08
R1997:Pms2 UTSW 5 143913700 missense probably damaging 1.00
R2248:Pms2 UTSW 5 143916506 missense probably damaging 1.00
R2873:Pms2 UTSW 5 143911914 splice site probably benign
R4072:Pms2 UTSW 5 143929001 missense probably damaging 0.99
R4082:Pms2 UTSW 5 143931019 missense probably damaging 1.00
R4358:Pms2 UTSW 5 143925926 missense probably damaging 1.00
R5100:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5101:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5228:Pms2 UTSW 5 143923597 missense probably damaging 0.99
R6310:Pms2 UTSW 5 143923583 missense probably benign 0.06
R6331:Pms2 UTSW 5 143914633 missense possibly damaging 0.94
R6567:Pms2 UTSW 5 143928968 missense probably damaging 0.99
R6718:Pms2 UTSW 5 143923489 missense probably damaging 0.98
R6747:Pms2 UTSW 5 143925419 missense probably benign 0.02
R6980:Pms2 UTSW 5 143912024 missense probably benign 0.21
R7207:Pms2 UTSW 5 143913634 missense probably damaging 1.00
R7349:Pms2 UTSW 5 143925836 missense probably benign 0.11
X0064:Pms2 UTSW 5 143916466 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTGATTATGTGGATAACTGAGG -3'
(R):5'- GAACTCTGAAGCCTGTGTGC -3'

Sequencing Primer
(F):5'- CAAGACAGGGTTTCTCTGTATAGCC -3'
(R):5'- TGTGCACCCACGTGATGAG -3'
Posted On2016-10-05