Incidental Mutation 'R5484:Cttnbp2'
ID430302
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 043045-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R5484 (G1)
Quality Score174
Status Validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 18427690 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000148602]
Predicted Effect probably benign
Transcript: ENSMUST00000090601
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139557
Predicted Effect probably benign
Transcript: ENSMUST00000146775
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148602
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202396
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Abca6 A T 11: 110,184,073 V1388E probably damaging Het
Alx1 T A 10: 103,025,316 D117V probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Dmxl1 T A 18: 49,889,464 V1623E probably damaging Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Plxnb2 T C 15: 89,164,209 probably null Het
Pms2 T C 5: 143,928,125 I675T probably damaging Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc13a2 G A 11: 78,404,822 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Strip2 C A 6: 29,917,155 probably benign Het
Tbx4 A G 11: 85,914,404 T440A probably damaging Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCTTCTTCATTAAGCAGCATTG -3'
(R):5'- GTGTGATAGCCAACTTGGTTTCC -3'

Sequencing Primer
(F):5'- GATAATAAAGTGACATTTCCCTGGGC -3'
(R):5'- TGGGTTTGTGCTAAGAAAG -3'
Posted On2016-10-05