Incidental Mutation 'R5484:Strip2'
ID430303
Institutional Source Beutler Lab
Gene Symbol Strip2
Ensembl Gene ENSMUSG00000039629
Gene Namestriatin interacting protein 2
SynonymsFam40b, D330017J20Rik
MMRRC Submission 043045-MU
Accession Numbers

Genbank: NM_177204.3, NM_001037740.1; Ensembl: ENSMUST00000046028

Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5484 (G1)
Quality Score156
Status Validated
Chromosome6
Chromosomal Location29917012-29959681 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 29917155 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046028] [ENSMUST00000102995] [ENSMUST00000115224] [ENSMUST00000115238] [ENSMUST00000115242] [ENSMUST00000151738]
Predicted Effect unknown
Transcript: ENSMUST00000046028
AA Change: N27K
SMART Domains Protein: ENSMUSP00000036477
Gene: ENSMUSG00000039629
AA Change: N27K

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 822 4.98e-199 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102995
SMART Domains Protein: ENSMUSP00000100060
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 142 172 N/A INTRINSIC
AdoHcyase 186 611 4.47e-268 SMART
AdoHcyase_NAD 371 532 2.21e-103 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115224
AA Change: N27K
SMART Domains Protein: ENSMUSP00000110879
Gene: ENSMUSG00000039629
AA Change: N27K

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 662 4.85e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115238
SMART Domains Protein: ENSMUSP00000110893
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115242
SMART Domains Protein: ENSMUSP00000110897
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 143 173 N/A INTRINSIC
AdoHcyase 187 612 4.47e-268 SMART
AdoHcyase_NAD 372 533 2.21e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149816
Predicted Effect unknown
Transcript: ENSMUST00000151738
AA Change: N27K
SMART Domains Protein: ENSMUSP00000119506
Gene: ENSMUSG00000039629
AA Change: N27K

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 794 1.72e-161 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201689
Meta Mutation Damage Score 0.0456 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Abca6 A T 11: 110,184,073 V1388E probably damaging Het
Alx1 T A 10: 103,025,316 D117V probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Cttnbp2 T A 6: 18,427,690 probably benign Het
Dmxl1 T A 18: 49,889,464 V1623E probably damaging Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Plxnb2 T C 15: 89,164,209 probably null Het
Pms2 T C 5: 143,928,125 I675T probably damaging Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc13a2 G A 11: 78,404,822 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Tbx4 A G 11: 85,914,404 T440A probably damaging Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Strip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Strip2 APN 6 29931214 missense probably benign 0.04
IGL01357:Strip2 APN 6 29939167 splice site probably benign
IGL01636:Strip2 APN 6 29931193 missense probably benign 0.06
IGL01959:Strip2 APN 6 29928554 missense probably damaging 0.99
IGL01961:Strip2 APN 6 29928427 splice site probably benign
IGL02089:Strip2 APN 6 29917180 unclassified probably benign
1mM(1):Strip2 UTSW 6 29955631 missense probably damaging 1.00
R0079:Strip2 UTSW 6 29920533 critical splice donor site probably null
R0331:Strip2 UTSW 6 29926560 missense probably benign 0.44
R0367:Strip2 UTSW 6 29937651 missense possibly damaging 0.90
R0592:Strip2 UTSW 6 29931210 missense probably benign 0.28
R1087:Strip2 UTSW 6 29927634 missense probably damaging 0.99
R1390:Strip2 UTSW 6 29929829 missense probably damaging 1.00
R1758:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2213:Strip2 UTSW 6 29931148 missense probably damaging 0.99
R2437:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2900:Strip2 UTSW 6 29939035 critical splice acceptor site probably null
R3892:Strip2 UTSW 6 29917075 unclassified probably benign
R4010:Strip2 UTSW 6 29955585 missense possibly damaging 0.66
R4435:Strip2 UTSW 6 29925050 missense probably benign 0.06
R4807:Strip2 UTSW 6 29925093 nonsense probably null
R5015:Strip2 UTSW 6 29931266 missense probably benign 0.03
R5080:Strip2 UTSW 6 29945593 missense probably damaging 0.99
R5502:Strip2 UTSW 6 29927624 missense probably benign 0.23
R5899:Strip2 UTSW 6 29956958 utr 3 prime probably benign
R6004:Strip2 UTSW 6 29926571 missense probably damaging 0.98
R6479:Strip2 UTSW 6 29944497 splice site probably null
R6835:Strip2 UTSW 6 29941917 missense probably damaging 1.00
R7068:Strip2 UTSW 6 29932208 missense probably benign 0.03
R7073:Strip2 UTSW 6 29941912 missense possibly damaging 0.95
R7088:Strip2 UTSW 6 29920533 critical splice donor site probably null
R7231:Strip2 UTSW 6 29944487 missense probably damaging 0.96
R7399:Strip2 UTSW 6 29927613 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAGCCAATCGGAGTTCAGG -3'
(R):5'- GGAAAGTATCTGTTACGCTCTTCGC -3'

Sequencing Primer
(F):5'- ATCGGAGTTCAGGGGGCG -3'
(R):5'- TTCGCGCCGGTTAGGAAAAC -3'
Posted On2016-10-05