Incidental Mutation 'R5484:Alx1'
ID430321
Institutional Source Beutler Lab
Gene Symbol Alx1
Ensembl Gene ENSMUSG00000036602
Gene NameALX homeobox 1
SynonymsCart1
MMRRC Submission 043045-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5484 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location102998707-103030215 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103025316 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 117 (D117V)
Ref Sequence ENSEMBL: ENSMUSP00000152018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040859] [ENSMUST00000167156] [ENSMUST00000217946] [ENSMUST00000218282] [ENSMUST00000218681] [ENSMUST00000219194]
Predicted Effect probably damaging
Transcript: ENSMUST00000040859
AA Change: D117V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042512
Gene: ENSMUSG00000036602
AA Change: D117V

DomainStartEndE-ValueType
HOX 132 194 1.84e-25 SMART
Pfam:OAR 301 321 7.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164226
Predicted Effect probably damaging
Transcript: ENSMUST00000167156
AA Change: D117V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129230
Gene: ENSMUSG00000036602
AA Change: D117V

DomainStartEndE-ValueType
HOX 132 194 1.84e-25 SMART
Pfam:OAR 302 320 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170026
Predicted Effect possibly damaging
Transcript: ENSMUST00000217946
AA Change: D117V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000218282
AA Change: D117V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218508
Predicted Effect probably damaging
Transcript: ENSMUST00000218681
AA Change: D117V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219194
AA Change: D117V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has yet to be determined in humans; however, in rodents, it is necessary for survival of the forebrain mesenchyme and may also be involved in development of the cervix. Mutations in the mouse gene lead to neural tube defects such as acrania and meroanencephaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit perinatal lethality with acrania and meroanencephaly, but the neural tube closure defect can be ameliorated with prenatal folic acid treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Abca6 A T 11: 110,184,073 V1388E probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Cttnbp2 T A 6: 18,427,690 probably benign Het
Dmxl1 T A 18: 49,889,464 V1623E probably damaging Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Plxnb2 T C 15: 89,164,209 probably null Het
Pms2 T C 5: 143,928,125 I675T probably damaging Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc13a2 G A 11: 78,404,822 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Strip2 C A 6: 29,917,155 probably benign Het
Tbx4 A G 11: 85,914,404 T440A probably damaging Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Alx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02331:Alx1 APN 10 103022299 missense possibly damaging 0.93
IGL02508:Alx1 APN 10 103022193 missense probably damaging 0.99
IGL03079:Alx1 APN 10 103009348 missense probably damaging 1.00
R1345:Alx1 UTSW 10 103028492 missense possibly damaging 0.86
R1370:Alx1 UTSW 10 103028492 missense possibly damaging 0.86
R1846:Alx1 UTSW 10 103025304 missense possibly damaging 0.88
R1912:Alx1 UTSW 10 103025361 missense probably damaging 1.00
R4649:Alx1 UTSW 10 103009332 missense probably damaging 0.99
R4767:Alx1 UTSW 10 103025186 nonsense probably null
R5979:Alx1 UTSW 10 103022259 missense probably damaging 1.00
R6115:Alx1 UTSW 10 103028443 missense possibly damaging 0.78
R6919:Alx1 UTSW 10 103025200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTAGCTGAGAATGCTTCTTCC -3'
(R):5'- GTATGTTTCACCACCCTGAGTATC -3'

Sequencing Primer
(F):5'- GAAAAGCCCTGCCTTTTGG -3'
(R):5'- ACCCTGAGTATCGCTGTTTTC -3'
Posted On2016-10-05