Incidental Mutation 'R5484:Plxnb2'
ID430338
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission 043045-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5484 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 89164209 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably null
Transcript: ENSMUST00000060808
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109331
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Meta Mutation Damage Score 0.6296 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Abca6 A T 11: 110,184,073 V1388E probably damaging Het
Alx1 T A 10: 103,025,316 D117V probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Cttnbp2 T A 6: 18,427,690 probably benign Het
Dmxl1 T A 18: 49,889,464 V1623E probably damaging Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Pms2 T C 5: 143,928,125 I675T probably damaging Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc13a2 G A 11: 78,404,822 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Strip2 C A 6: 29,917,155 probably benign Het
Tbx4 A G 11: 85,914,404 T440A probably damaging Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACAGTCTCCAAGTTCTTGCC -3'
(R):5'- AGTCCTGGCTACCTTGTGAGAG -3'

Sequencing Primer
(F):5'- AAGTTCTTGCCCTGGAAGGTCAC -3'
(R):5'- CTTGTGAGAGGTTCCCCAC -3'
Posted On2016-10-05