Incidental Mutation 'R5487:Plxna4'
ID430406
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission 043048-MU
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32517283 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 133 (Y133H)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably damaging
Transcript: ENSMUST00000115096
AA Change: Y133H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: Y133H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150314
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGCCATCCACTGCTGTG -3'
(R):5'- GAGGACAGGGCACATTTATTTGG -3'

Sequencing Primer
(F):5'- GCTGTGGCAATAAAGAGTTTATCATC -3'
(R):5'- TTGGGGGCTGTCAACAGAATCTAC -3'
Posted On2016-10-05