Incidental Mutation 'R5488:Cd48'
ID430437
Institutional Source Beutler Lab
Gene Symbol Cd48
Ensembl Gene ENSMUSG00000015355
Gene NameCD48 antigen
SynonymsBcm-1, BCM1, BLAST-1, Sgp-60
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171682009-171705258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 171695705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 39 (V39I)
Ref Sequence ENSEMBL: ENSMUSP00000015499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015499] [ENSMUST00000068584]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015499
AA Change: V39I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015499
Gene: ENSMUSG00000015355
AA Change: V39I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000068584
AA Change: V39I

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064241
Gene: ENSMUSG00000015355
AA Change: V39I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
IG_like 136 211 1.24e2 SMART
Meta Mutation Damage Score 0.0564 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in a slight increase in CD4+CD8- thymocytes and impaired T cell proliferation in response to mitogens, anti-CD3 antibodies, and alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Cd48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Cd48 APN 1 171695739 missense possibly damaging 0.95
IGL03140:Cd48 APN 1 171695883 missense probably damaging 1.00
R0311:Cd48 UTSW 1 171699580 nonsense probably null
R0490:Cd48 UTSW 1 171704877 makesense probably null
R1365:Cd48 UTSW 1 171699561 missense probably damaging 0.98
R1503:Cd48 UTSW 1 171695847 missense probably damaging 1.00
R1626:Cd48 UTSW 1 171682119 missense probably benign 0.30
R1628:Cd48 UTSW 1 171704852 missense probably damaging 0.99
R4076:Cd48 UTSW 1 171695883 missense probably damaging 1.00
R4753:Cd48 UTSW 1 171699588 missense probably damaging 0.99
R6365:Cd48 UTSW 1 171682164 missense probably null 0.84
R7216:Cd48 UTSW 1 171695822 missense probably damaging 1.00
R7400:Cd48 UTSW 1 171695925 missense probably benign 0.00
Z1088:Cd48 UTSW 1 171695727 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGTAAGTTCTGTTCCACCCTG -3'
(R):5'- CGCAGCACTCTCATGTAGTAGG -3'

Sequencing Primer
(F):5'- GTCCTGCCTTACCCCATTTCATAGG -3'
(R):5'- CCTCTTTCCGGACATTAGAGATATG -3'
Posted On2016-10-05