Incidental Mutation 'R5488:Kctd3'
ID430438
Institutional Source Beutler Lab
Gene Symbol Kctd3
Ensembl Gene ENSMUSG00000026608
Gene Namepotassium channel tetramerisation domain containing 3
SynonymsE330032J19Rik, NY-REN-45, 4930438A20Rik
MMRRC Submission 043049-MU
Accession Numbers

Genbank: NM_172650; MGI: 2444629

Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R5488 (G1)
Quality Score218
Status Validated
Chromosome1
Chromosomal Location188971095-189007841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 188981366 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 391 (Y391H)
Ref Sequence ENSEMBL: ENSMUSP00000141861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085678] [ENSMUST00000192458] [ENSMUST00000193143]
Predicted Effect probably damaging
Transcript: ENSMUST00000085678
AA Change: Y391H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082821
Gene: ENSMUSG00000026608
AA Change: Y391H

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
BTB 18 118 1.74e-15 SMART
Blast:WD40 184 263 5e-50 BLAST
WD40 269 305 1.32e2 SMART
WD40 411 449 7.43e-1 SMART
WD40 519 569 2.66e0 SMART
low complexity region 619 637 N/A INTRINSIC
low complexity region 774 801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192458
Predicted Effect probably damaging
Transcript: ENSMUST00000193143
AA Change: Y391H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141861
Gene: ENSMUSG00000026608
AA Change: Y391H

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
BTB 18 118 1.1e-17 SMART
Blast:WD40 184 263 3e-49 BLAST
WD40 269 305 8.1e-1 SMART
WD40 411 449 4.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193590
Predicted Effect probably benign
Transcript: ENSMUST00000195658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195787
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel tetramerization-domain containing (KCTD) protein family. Members of this protein family regulate the biophysical characteristics of ion channels. In mouse, this protein interacts with hyperpolarization-activated cyclic nucleotide-gated channel complex 3 and enhances its cell surface expression and current density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Kctd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Kctd3 APN 1 188972196 missense probably damaging 1.00
IGL00766:Kctd3 APN 1 188995776 missense probably benign 0.29
IGL01393:Kctd3 APN 1 189000290 missense probably benign 0.03
IGL01874:Kctd3 APN 1 188996991 missense probably damaging 1.00
IGL01966:Kctd3 APN 1 188992662 missense probably damaging 1.00
3-1:Kctd3 UTSW 1 188972257 nonsense probably null
R0026:Kctd3 UTSW 1 188976621 missense probably damaging 1.00
R0142:Kctd3 UTSW 1 188996398 critical splice donor site probably null
R0619:Kctd3 UTSW 1 188978643 missense probably damaging 1.00
R0621:Kctd3 UTSW 1 188981341 missense probably damaging 1.00
R0733:Kctd3 UTSW 1 188997050 splice site probably benign
R0843:Kctd3 UTSW 1 188996973 nonsense probably null
R2393:Kctd3 UTSW 1 188981371 missense probably damaging 1.00
R4004:Kctd3 UTSW 1 188992743 missense probably benign 0.06
R4005:Kctd3 UTSW 1 189001927 missense possibly damaging 0.96
R4091:Kctd3 UTSW 1 188995720 intron probably benign
R4784:Kctd3 UTSW 1 188974468 missense probably damaging 1.00
R5062:Kctd3 UTSW 1 188995693 intron probably benign
R6013:Kctd3 UTSW 1 188996468 missense probably benign 0.00
R6310:Kctd3 UTSW 1 188972238 missense probably benign 0.00
R6478:Kctd3 UTSW 1 188972364 missense probably benign
R6703:Kctd3 UTSW 1 188996529 missense probably damaging 1.00
X0019:Kctd3 UTSW 1 188972589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTTCCATGCAGCATAAGC -3'
(R):5'- ATGGCCAGAAGCAGTTTCAC -3'

Sequencing Primer
(F):5'- TCTCTCAGCACGGAGTCAC -3'
(R):5'- TCAAGAAACACGTGTAAAGGAATTAC -3'
Posted On2016-10-05