Incidental Mutation 'R5488:Wdr5'
ID430442
Institutional Source Beutler Lab
Gene Symbol Wdr5
Ensembl Gene ENSMUSG00000026917
Gene NameWD repeat domain 5
SynonymsBmp2-induced gene, 2410008O07Rik, Big-3
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location27515157-27536535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 27525153 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 192 (D192E)
Ref Sequence ENSEMBL: ENSMUSP00000109585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113952]
PDB Structure
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE RECRUITED TO NOVEL SITE [X-RAY DIFFRACTION]
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE AND HISTONE H3 PEPTIDE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000113952
AA Change: D192E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109585
Gene: ENSMUSG00000026917
AA Change: D192E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
WD40 34 73 4.11e-10 SMART
WD40 76 115 1.69e-11 SMART
WD40 118 157 9.22e-13 SMART
WD40 160 199 1.84e-12 SMART
WD40 202 242 7.33e-7 SMART
WD40 245 287 1.17e-5 SMART
WD40 290 331 3.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125088
Predicted Effect unknown
Transcript: ENSMUST00000140396
AA Change: D122E
SMART Domains Protein: ENSMUSP00000121654
Gene: ENSMUSG00000026917
AA Change: D122E

DomainStartEndE-ValueType
WD40 7 46 1.69e-11 SMART
WD40 49 88 9.22e-13 SMART
WD40 91 130 1.84e-12 SMART
WD40 133 189 1.33e-4 SMART
WD40 192 234 1.17e-5 SMART
WD40 237 278 3.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144315
Meta Mutation Damage Score 0.388 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 7 WD repeats. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Wdr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Wdr5 APN 2 27520867 missense probably benign 0.00
IGL01478:Wdr5 APN 2 27533832 missense probably damaging 1.00
IGL02690:Wdr5 APN 2 27534828 missense probably benign 0.08
IGL02742:Wdr5 APN 2 27520425 splice site probably benign
IGL03059:Wdr5 APN 2 27519734 unclassified probably benign
R0241:Wdr5 UTSW 2 27533013 missense probably damaging 1.00
R0630:Wdr5 UTSW 2 27520607 missense probably benign 0.05
R0738:Wdr5 UTSW 2 27519412 missense probably damaging 1.00
R1329:Wdr5 UTSW 2 27531671 missense probably damaging 1.00
R4130:Wdr5 UTSW 2 27520429 splice site probably benign
R5859:Wdr5 UTSW 2 27533350 missense probably damaging 1.00
R5879:Wdr5 UTSW 2 27528311 missense probably benign 0.01
R6775:Wdr5 UTSW 2 27533374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGATGCCCTCGAGATTTAG -3'
(R):5'- TTTGAAAGGGTACACTCAGGGG -3'

Sequencing Primer
(F):5'- GATGCCCTCGAGATTTAGATAAAC -3'
(R):5'- TACACTCAGGGGCATGCAAG -3'
Posted On2016-10-05