Incidental Mutation 'R5488:D630003M21Rik'
ID430445
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene NameRIKEN cDNA D630003M21 gene
Synonyms
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158182533-158229222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158217021 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 320 (T320S)
Ref Sequence ENSEMBL: ENSMUSP00000130623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]
Predicted Effect probably benign
Transcript: ENSMUST00000046944
AA Change: T320S

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: T320S

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 1e-6 BLAST
SCOP:d1aua_2 567 711 5e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103121
AA Change: T320S

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: T320S

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169335
AA Change: T320S

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: T320S

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158213412 missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158217356 missense probably benign
IGL01501:D630003M21Rik APN 2 158201067 missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158204724 missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158203210 missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158210171 missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158217488 missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158216810 missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158200998 missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158217285 missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158216744 missense probably benign
IGL03148:D630003M21Rik APN 2 158217224 missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158217648 missense probably benign
F5770:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158196575 missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158203067 splice site probably benign
R0513:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158195407 intron probably benign
R1594:D630003M21Rik UTSW 2 158211630 missense probably damaging 1.00
R1774:D630003M21Rik UTSW 2 158220470 missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158217557 missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158203185 missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158208421 missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158215849 missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158204711 missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158201011 missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158195472 intron probably benign
R3937:D630003M21Rik UTSW 2 158200360 missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158196593 missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158216703 missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158196139 missense probably benign
R4947:D630003M21Rik UTSW 2 158186196 missense unknown
R5005:D630003M21Rik UTSW 2 158211643 missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158217633 missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158205745 missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158201035 missense probably benign 0.06
R5489:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158220511 missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158220392 splice site probably null
R5770:D630003M21Rik UTSW 2 158195580 intron probably benign
R5789:D630003M21Rik UTSW 2 158216814 missense possibly damaging 0.63
R5817:D630003M21Rik UTSW 2 158196493 missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158204657 splice site probably null
R5969:D630003M21Rik UTSW 2 158217708 missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158217584 missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158213448 missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158217401 missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158215951 missense probably benign 0.34
R6350:D630003M21Rik UTSW 2 158220495 missense probably damaging 1.00
R6548:D630003M21Rik UTSW 2 158205699 critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158220516 missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158204774 missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158216750 missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158216012 critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158217209 missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158200224 missense probably damaging 1.00
V7580:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCTCCGGGACACTAGTATGG -3'
(R):5'- TATCCAGGGCTCATCAAGGTG -3'

Sequencing Primer
(F):5'- GACACTAGTATGGGGCTGC -3'
(R):5'- TCGCCTTTAGGACAGACAGTG -3'
Posted On2016-10-05